Mutagenetix > Incidental Mutations

Incidental Mutation 'R4614:Ass1'

344909

Institutional Source

Beutler Lab

Gene Symbol

Ass1

Ensembl Gene

ENSMUSG00000076441

Gene Name

argininosuccinate synthetase 1

Synonyms

Ass-1, ASS, fold

MMRRC Submission

041825-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R4614 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

31470207-31520672 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 31514783 bp

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Histidine at position 359 (Y359H)

Ref Sequence

ENSEMBL: ENSMUSP00000099904 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000102840]

Predicted Effect

probably damaging
Transcript: ENSMUST00000102840
AA Change: Y359H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000099904
Gene: ENSMUSG00000076441
AA Change: Y359H

Domain	Start	End	E-Value	Type
Pfam:QueC	6	93	2.8e-7	PFAM
Pfam:Arginosuc_synth	8	403	1.9e-177	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000126474

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000130195

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000192802

Meta Mutation Damage Score

0.5987

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.3%
20x: 95.2%

Validation Efficiency

98% (95/97)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene catalyzes the penultimate step of the arginine biosynthetic pathway. There are approximately 10 to 14 copies of this gene including the pseudogenes scattered across the human genome, among which the one located on chromosome 9 appears to be the only functional gene for argininosuccinate synthetase. Mutations in the chromosome 9 copy of this gene cause citrullinemia. Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Aug 2012]
PHENOTYPE: Targeted disruption of this gene results in high levels of blood citrulline, hyperammonemia, and death by 24 hours after birth. Some spontaneous mutations display wrinkled skin, sparse hair with delayed hair appearance and abnormal hair follicle morphology. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 88 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2210408I21Rik	T	G	13: 77,254,256		probably null	Het
4932414N04Rik	C	A	2: 68,745,460	T701K	probably benign	Het
6030419C18Rik	AGAGGAGGAGGAGGAGG	AGAGGAGGAGGAGG	9: 58,499,432		probably benign	Het
Abcb11	A	T	2: 69,284,681	H640Q	possibly damaging	Het
Ago2	C	T	15: 73,130,967	V139M	probably damaging	Het
Apol11a	A	T	15: 77,516,572	K86N	probably benign	Het
Bpifa3	A	T	2: 154,136,280	N34I	probably damaging	Het
Brwd1	A	T	16: 96,047,359	L540H	probably damaging	Het
C3ar1	G	A	6: 122,850,721	S179F	probably benign	Het
Ccnb1ip1	T	C	14: 50,792,195	T137A	probably benign	Het
Cd5l	A	G	3: 87,368,619	T299A	probably benign	Het
Cdk12	T	A	11: 98,249,777		probably benign	Het
Cep290	T	C	10: 100,508,740	M480T	probably benign	Het
Cep290	G	A	10: 100,559,687	R2112K	possibly damaging	Het
Chn2	G	A	6: 54,290,403	M292I	probably damaging	Het
Cic	TCCCCC	TCCCCCCC	7: 25,291,670		probably null	Het
Cpeb1	A	T	7: 81,436,270	D41E	possibly damaging	Het
Csf2rb2	C	G	15: 78,291,702	C184S	probably damaging	Het
Ctsc	G	A	7: 88,278,375		probably null	Het
Cyp2c40	G	A	19: 39,803,856	S191L	probably damaging	Het
Dagla	T	C	19: 10,248,277	E841G	probably damaging	Het
Dld	A	T	12: 31,333,945	Y386*	probably null	Het
Dpp8	G	A	9: 65,066,396	S634N	probably benign	Het
Duox2	A	T	2: 122,289,557	V824E	probably damaging	Het
Dync2h1	A	C	9: 7,011,290	S3634R	probably benign	Het
Eef1d	T	C	15: 75,903,576	N78S	probably benign	Het
Fcrl5	T	A	3: 87,448,426	I482N	probably damaging	Het
Fezf1	A	T	6: 23,247,858	C73S	possibly damaging	Het
Fgfr1	A	G	8: 25,557,797	D53G	probably benign	Het
Fmn1	T	C	2: 113,365,149	L398S	unknown	Het
Gm17175	T	C	14: 51,571,585	Q108R	probably benign	Het
Gm28042	G	A	2: 120,041,158	G669D	probably damaging	Het
Gm6185	A	G	1: 161,223,099		noncoding transcript	Het
Gucy2g	A	T	19: 55,202,147	C1018*	probably null	Het
H2-Q10	A	T	17: 35,474,020		probably benign	Het
H2-T22	T	G	17: 36,040,537	Q267P	probably benign	Het
Hibadh	A	G	6: 52,546,930	Y328H	possibly damaging	Het
Hsd3b3	T	A	3: 98,742,080	Y309F	probably benign	Het
Ighv1-37	C	T	12: 114,896,243	A116T	probably benign	Het
Ighv1-82	T	C	12: 115,952,660	T77A	probably benign	Het
Igkv8-21	A	T	6: 70,315,157	S34T	probably benign	Het
Iqch	A	G	9: 63,482,581	M733T	probably benign	Het
Jakmip2	T	A	18: 43,562,592	D539V	probably damaging	Het
Lgi2	A	G	5: 52,538,433	S395P	probably damaging	Het
Lrrc40	A	T	3: 158,054,634	N344I	probably damaging	Het
Ltbp1	G	A	17: 75,289,994		probably benign	Het
Metap1d	C	T	2: 71,524,948	P332L	probably benign	Het
Mfap4	C	A	11: 61,485,509		probably benign	Het
Mis18bp1	T	A	12: 65,153,529		probably benign	Het
Mta2	T	C	19: 8,948,128		probably null	Het
Mtmr4	T	C	11: 87,610,935	L548S	probably damaging	Het
Muc4	A	G	16: 32,757,058	K241E	probably benign	Het
Mup18	T	A	4: 61,671,917	I125F	possibly damaging	Het
Nfs1	A	G	2: 156,144,050	S31P	probably benign	Het
Olfr38	G	T	6: 42,762,418	R122L	probably benign	Het
Olfr419	A	G	1: 174,250,622	F102L	possibly damaging	Het
Olfr981	T	A	9: 40,022,959	C189S	probably damaging	Het
Otogl	A	T	10: 107,892,124	C245*	probably null	Het
Pcdhb16	G	A	18: 37,480,345	G786D	probably benign	Het
Pdcd5	C	T	7: 35,647,047		probably benign	Het
Phkg2	C	T	7: 127,577,620	R61W	probably damaging	Het
Piezo1	A	T	8: 122,486,411	I1871N	probably benign	Het
Pkd2l1	C	A	19: 44,154,134	A490S	probably damaging	Het
Plxnd1	T	C	6: 115,972,525	T767A	possibly damaging	Het
Polr3c	T	G	3: 96,716,471	I322L	probably benign	Het
Ppp1r26	C	A	2: 28,450,848	H163Q	probably benign	Het
Prox1	T	G	1: 190,162,008	Y80S	probably damaging	Het
Pygl	T	C	12: 70,210,979		probably null	Het
Rab23	T	C	1: 33,739,385	V236A	probably benign	Het
Setd2	T	C	9: 110,569,813		probably null	Het
Slc5a7	A	G	17: 54,276,559	S568P	probably benign	Het
Smpd3	A	G	8: 106,259,739	L477P	probably damaging	Het
Spg21	A	G	9: 65,480,389		probably null	Het
Spta1	A	T	1: 174,192,977	I551F	probably damaging	Het
Supt5	A	T	7: 28,325,972	I135N	possibly damaging	Het
Tacstd2	A	G	6: 67,535,186	F174S	probably damaging	Het
Tas1r2	A	T	4: 139,659,787	T186S	probably damaging	Het
Tie1	A	G	4: 118,479,051	Y673H	probably damaging	Het
Tom1l1	A	T	11: 90,671,126	N190K	probably damaging	Het
Tox2	T	C	2: 163,320,647	L479P	probably damaging	Het
Tox4	C	T	14: 52,287,467	T249I	probably damaging	Het
Trmt1l	C	T	1: 151,454,048	Q581*	probably null	Het
Vmn1r49	A	G	6: 90,072,552	V156A	probably benign	Het
Vmn2r13	A	T	5: 109,175,199	F75I	probably benign	Het
Washc2	T	A	6: 116,238,174	S502T	possibly damaging	Het
Wnk4	A	T	11: 101,274,111	E755D	probably benign	Het
Zfp207	T	A	11: 80,395,190		probably benign	Het
Zfp352	A	G	4: 90,225,081	K486R	probably benign	Het

Other mutations in Ass1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01413:Ass1	APN	2	31476922	missense	probably damaging	1.00
IGL02152:Ass1	APN	2	31492324	missense	probably damaging	1.00
R0008:Ass1	UTSW	2	31514819	missense	probably damaging	1.00
R0083:Ass1	UTSW	2	31514819	missense	probably damaging	1.00
R0084:Ass1	UTSW	2	31514819	missense	probably damaging	1.00
R0085:Ass1	UTSW	2	31514819	missense	probably damaging	1.00
R0087:Ass1	UTSW	2	31514819	missense	probably damaging	1.00
R0183:Ass1	UTSW	2	31514819	missense	probably damaging	1.00
R0220:Ass1	UTSW	2	31514819	missense	probably damaging	1.00
R0254:Ass1	UTSW	2	31514819	missense	probably damaging	1.00
R0302:Ass1	UTSW	2	31514819	missense	probably damaging	1.00
R0346:Ass1	UTSW	2	31514819	missense	probably damaging	1.00
R0440:Ass1	UTSW	2	31514819	missense	probably damaging	1.00
R0472:Ass1	UTSW	2	31514819	missense	probably damaging	1.00
R0605:Ass1	UTSW	2	31514819	missense	probably damaging	1.00
R0644:Ass1	UTSW	2	31514819	missense	probably damaging	1.00
R1460:Ass1	UTSW	2	31514741	missense	probably benign	0.37
R1465:Ass1	UTSW	2	31520416	makesense	probably null
R1465:Ass1	UTSW	2	31520416	makesense	probably null
R1770:Ass1	UTSW	2	31486516	missense	probably benign	0.29
R1908:Ass1	UTSW	2	31493148	nonsense	probably null
R2361:Ass1	UTSW	2	31520382	missense	probably benign	0.02
R2430:Ass1	UTSW	2	31501496	missense	probably damaging	1.00
R3816:Ass1	UTSW	2	31510105	splice site	probably benign
R4628:Ass1	UTSW	2	31480988	missense	probably damaging	1.00
R5007:Ass1	UTSW	2	31501532	missense	possibly damaging	0.90
R5069:Ass1	UTSW	2	31510173	missense	probably damaging	1.00
R5081:Ass1	UTSW	2	31488653	critical splice donor site	probably null
R5315:Ass1	UTSW	2	31492329	missense	probably benign	0.21
R5370:Ass1	UTSW	2	31518733	missense	possibly damaging	0.56
R6259:Ass1	UTSW	2	31488642	missense	possibly damaging	0.80
R6541:Ass1	UTSW	2	31510233	missense	probably damaging	0.99
R6731:Ass1	UTSW	2	31514784	missense	probably damaging	1.00
R6927:Ass1	UTSW	2	31514801	missense	probably damaging	1.00
R7811:Ass1	UTSW	2	31514741	missense	probably benign	0.37
R7995:Ass1	UTSW	2	31486540	missense	probably benign	0.00
R8504:Ass1	UTSW	2	31501532	missense	possibly damaging	0.90

Predicted Primers

PCR Primer
(F):5'- AGCCTATCAGAAGGTAAGGCC -3'
(R):5'- TGGCTTGTAGGTTCCATGAC -3'

Sequencing Primer
(F):5'- TAAGGCCTGGGCTCTGCTC -3'
(R):5'- GCTTGTAGGTTCCATGACATTACAG -3'

Posted On

2015-09-25