Incidental Mutation 'R0103:Ctns'

• ID: 34491
• Institutional Source: Beutler Lab
• Gene Symbol: Ctns
• Ensembl Gene: ENSMUSG00000005949
• Gene Name: cystinosis, nephropathic
• MMRRC Submission: 038389-MU
• Essential gene?: Probably non essential (E-score: 0.116)
• Stock #: R0103 (G1)
• Quality Score: 225
• Status: Validated
• Chromosome: 11
• Chromosomal Location: 73074422-73089868 bp(-) (GRCm39)
• Type of Mutation: missense
• DNA Base Change (assembly): A to C at 73076137 bp (GRCm39)
• Zygosity: Heterozygous
• Amino Acid Change: Isoleucine to Methionine at position 299 (I299M)
• Ref Sequence: ENSEMBL: ENSMUSP00000104116
• Gene Model: predicted gene model for transcript(s): [ENSMUST00000006103] [ENSMUST00000040687] [ENSMUST00000108476] [ENSMUST00000108477]
• AlphaFold: P57757
• Predicted Effect: probably damaging; Transcript: ENSMUST00000006103; AA Change: I299M; PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
• SMART Domains: Protein: ENSMUSP00000006103; Gene: ENSMUSG00000005949; AA Change: I299M

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
CTNS	140	171	6.43e-12	SMART
transmembrane domain	206	225	N/A	INTRINSIC
transmembrane domain	238	257	N/A	INTRINSIC
CTNS	279	310	1.47e-6	SMART
transmembrane domain	338	357	N/A	INTRINSIC

• Predicted Effect: probably benign; Transcript: ENSMUST00000040687
• SMART Domains: Protein: ENSMUSP00000047410; Gene: ENSMUSG00000040158

Domain	Start	End	E-Value	Type
PDZ	27	113	1.1e-20	SMART

• Predicted Effect: probably damaging; Transcript: ENSMUST00000108476; AA Change: I299M; PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
• SMART Domains: Protein: ENSMUSP00000104116; Gene: ENSMUSG00000005949; AA Change: I299M

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
CTNS	140	171	6.43e-12	SMART
transmembrane domain	206	225	N/A	INTRINSIC
transmembrane domain	238	257	N/A	INTRINSIC
CTNS	279	310	1.47e-6	SMART
transmembrane domain	338	357	N/A	INTRINSIC

• Predicted Effect: probably benign; Transcript: ENSMUST00000108477
• SMART Domains: Protein: ENSMUSP00000104117; Gene: ENSMUSG00000040158

Domain	Start	End	E-Value	Type
PDB:3DJ1|B	1	98	6e-63	PDB
SCOP:d1fc6a3	24	86	3e-7	SMART
Blast:PDZ	27	87	6e-33	BLAST

• Predicted Effect: noncoding transcript; Transcript: ENSMUST00000130101
• Predicted Effect: noncoding transcript; Transcript: ENSMUST00000133922
• Predicted Effect: noncoding transcript; Transcript: ENSMUST00000150407
• Meta Mutation Damage Score: 0.8175
• Coding Region Coverage:
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.8%
• Validation Efficiency: 99% (84/85)
• MGI Phenotype: FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a seven-transmembrane domain protein that functions to transport cystine out of lysosomes. Its activity is driven by the H+ electrochemical gradient of the lysosomal membrane. Mutations in this gene cause cystinosis, a lysosomal storage disorder. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2009] ; PHENOTYPE: Homozygotes for a targeted null mutation exhibit increased intracellular cystine, progressive accumulation of cystine crystals, occasional muscle impairment, reduced exploratory activity, osteoporosis, and lowered electroretinogram amplitude. [provided by MGI curators]
• Allele List at MGI:

  All alleles(2) : Targeted(2)

• Posted On: 2013-05-09
• Science Writer: Anne Murray
• Illustrator: Peter Jurek

Predicted Primers

PCR Primer
(F):5'- ATGGTGAAGACGCCAAGTCCGAAC -3'
(R):5'- GTGGAGAAACTAGGCAGCATTCCC -3'

Sequencing Primer
(F):5'- GGGTCTCCGAAGATCAATGTC -3'
(R):5'- CGATTGGAATCCAGAGATGGTG -3'

Nature of Mutation

The mutation is a T to G transversion at base pair 73,185,311 (v38) on chromosome 11, equivalent to base pair 13,709 in the GenBank genomic region NC_000077 encoding Ctns.  The mutation corresponds to residue 1,018 in the NM_031251 mRNA sequence in exon 10 of 11 total exons or at position 1,195 bp of the Ctns cDNA sequence (ENSMUST00000108476) in exon 11 of 12 total exons.

13692 ACCAAGGGCTGGAGCATTGGCGGTGTGCTCCTC 

294   -T--K--G--W--S--I--G--G--V--L--L- 

Genomic numbering corresponds to NC_000077. The mutated nucleotide is indicated in red lettering and results in a isoleucine (I) to methionine (M) substitution at amino acid 299 in both isoforms of the CTNS protein.

Protein Function and Prediction

Cystinosin (CTNS) is a 367-amino acid seven transmembrane domain (TM) cystine transporter in the lysosome (1). CTNS is highly conserved with the mouse and human CTNS proteins sharing 92.6% similarity). The N-terminus of CTNS is 128-amino acids in length and resides within the lumen of the lysosome (2). The N-terminus contains six putative N-glycosylation consensus sequences (N-X-S/T, where X is amino acid) that are predicted to result in glycosylation of N36, N51, N66, N84, N104, and N107. An additional asparagine (N41) is predicted to by glycosylated, however it is not within the canonical N-glycosylation consensus sequence (2). The 10-amino acid cytosolic C-terminal tail of CTNS contains a tyrosine-based lysosomal targeting signal (GYDQL; amino acids (aa) 362-366) that facilitates the delivery of CTNS to lysosomes (2;3). Mutations or deletions within the GYDQL sequence result in partial mislocalization of CTNS to the plasma membrane [(3;4); reviewed in (5)]. CTNS contains two PQ loop motifs (PQ---N---KS----S-----L---G; aa 144-169; 283-308). Proteins of the PQ loop repeat family (e.g., SL15, S. cerevisiae Endoplasmic reticulum defect suppressor 1 (ERS1p), D. melanogaster CG17119) are membrane-bound proteins that contain a pair of repeats each spanning two transmembrane helices connected by a loop [(6); NCBI]. The function of the first PQ loop motif is unknown (4). A pentapeptide, YFPQA, (aa 281-285) initiates the second PQ loop motif in the third cytoplasmic loop and is required for the correct sorting of CTNS (3). Deletion of the sequences that encode YFPQA and GYDQL resulted in the complete relocalization of CTNS to the plasma membrane (3). Mutating all of the residues within the YFPQA motif to alanines did not result in drastic changes to the localization of CTNS compared to the complete deletion of the pentapeptide, indicating that YFPQA acts as a conformational motif for the secondary structure of the third cytoplasmic loop and this conformation is essential for the localization of CTNS [(3); reviewed in (5)].  Asp305 (D305), an evolutionarily conserved site in a subset of PQ-loop motifs, is buried in TM6 and is the proton binding site cooperatively coupled to cystine binding (4). Mutation of D305 (D305N and D305E) resulted in abolished transient currents (4).

The I299M mutation is within the PQ-loop consensus sequence that begins within the third cytoplasmic loop and continues into the sixth transmembrane domain. Isoleucine 299 is highly conserved and is buried within the sixth transmembrane domain. 

Alternative splicing of the last exon of the mouse (exon 11 in ENSMUST00000006103 or exon 12 in ENSMUST00000108476) and human transcripts results in the generation of an alternative CTNS isoform, Ctns-lkg (7). The loss of the last exon results in the removal of 264 nucleotides from the canonical Ctns transcript and the subsequent coding of the CTNS-LKG protein that does not have the GYQDL motif or the Ctns stop codon (7). The open-reading frame of Ctns-lkg continues downstream of the spliced region, coding a protein with a unique C-terminal tail that is 400 amino acid longer than CTNS (7). Within the C-terminal tail of CTNS-LKG is an SSLK motif that is found in other endoplasmic reticulum (ER) membrane proteins (7). The function of the CTNS-LKG isoform is unknown, but is proposed to mediate cystine transport between the cell and the extracellular space (7). 

Expression/Localization

In the human, CTNS mRNA is highly expressed in the pancreas, kidney, skeletal muscle, melanocytes, to a lesser extent in placenta and heart, and weakly in the lung and liver (2;8). Depletion of both cystine and cysteine in HK2 human kidney cells for 48 hours led to a two-fold increase in CTNS mRNA with a concomitant increase in the expression of the CTNS protein, indicating that CTNS is regulated at both the transcriptional and posttranscriptional level by intracellular thiols (9;10). CTNS levels increased after inhibition of glutathione (GSH) synthesis and after the induction of an oxidative stress, both of which resulted in increased reactive oxygen species generation (9); ROS has been established as a broad activator of various biosynthesis and enzymatic pathways that regulate cell redox state (11). .

In the mouse, Ctns expression is highly expressed in the kidney, brain, liver, lung, and to a lesser extent in muscle; the differences in the mRNA expression pattern between the human and mouse was not discussed (1;8). Strong expression of Cnts was also detected in B16 mouse melanoma cells (8). In addition, Ctns expression increased during forskolin-induced differentiation of B16 melanoma cells, suggesting that CTNS is a member of the molecular program implemented during melanocyte differentiation (8).

The CTNS protein localizes to lysosomes (1;3;12). In B16 cells transfected with a full-length CTNS construct with a green fluorescent protein (GFP) tag (CTNS-GFP), CTNS-GFP colocalized with Tyrp1 in melanosome stages II to IV, and to a lesser extent with pMEL17 in stage II melanosomes (8).

CTNS-LKG is expressed in several cell types in the human; the expression pattern of CTNS-LKG in the mouse has not been examined (7). CTNS-LKG is targeted to lysosomes as well as to other cellular compartments including the plasma membrane, the Golgi apparatus, the ER, and cytosolic vesicles resembling endosomes (7).

Background

Figure 1. CTNS and the lysosome. Lysosomes function in breaking down cell components that are no longer needed, molecules ("food"), and bacteria ingested by the cell. Lysosomes breakdown "food" into simple compounds that can be returned to the cytoplasm. Lysosomes contain ~40 different hydrolytic enzymes to aid in the digestion of food. CTNS cotransports H + and cystine from the lysosomes. Proper CTNS funtion is required for regulation of lysosomal pH. The efflux of cystine from the lysosome subsequently results in the reduction of cystine to generate cysteineysosomes function.

The regulation of cysteine levels is required for the function of several metabolic pathways including protein and GSH synthesis, cell redox state, and redox-based signaling (13). Cytosolic cysteine originates from the reduction of lysosomal cystine (a disulfide-linked dimer of cysteine) by the reduced/oxidized glutathione (GSH/GSSG) redox couple (9). Cells generate cysteine from several metabolic pathways including the pyroglutamate cycle and the transulfuration pathway, from protein breakdown in the lysosomes, or by direct uptake of cystine from the extracellular space [Figure 1; (14;15)].

CTNS is a lysosomal cotransporter of H⁺ and cystine at a 1:1 stoichiometry (4), facilitating an efflux of cystine from lysosomes that can subsequently be used by the cell in cysteine generation [Figure 1; (1;2;9;12;16)]. Acidification of the lysosomal lumen via the H⁺-translocating ATPase actively drives CTNS-mediated transport in the efflux direction; at neutral pH, cystine accumulates within the lysosomal lumen (16).  Mutations in CTNS are linked to nephrophathic cystinosis (OMIM: #219800), a recessive disorder that results from impaired transport of cystine out of lysosomes (1;17). The accumulated cystine is poorly soluble and crystalizes in several cell types, leading to tissue degeneration. Patients are diagnosed with cystinosis by assaying for increased cystine levels in peripheral blood leukocytes or fibroblasts; cystine levels are proportional to disease severity (18).  Nephrotic cystinosis can be a late-onset juvenile (OMIM: #219900) type or an infantile (OMIM: #219800) type. Infantile cystinosis manifests between 6 and 12 months of age and typically affects between 1 in 100,000 and 1 in 200,000 live births [reviewed in (5)]. However, in some subpopulations, the incidence rate is reported to be higher (e.g., in the western French province of Brittany the incidence rate is 1 in 26,000 (19)). Infantile cystinosis patients exhibit Fanconi syndrome (OMIM: %134600) as a result of decreased solute and water reabsorption in the proximal tubule of the kidney leading to phosphaturia, glycosuria, and aminoaciduria as well as renal tubular acidosis, rickets, and growth retardation [(17); reviewed in (5)]. By 10 years of age, the patients have end-stage renal failure due to the glomerular impairment. The renal damage in infantile cystinosis is proposed to be caused by a number of factors including intracellular ATP depletion, decreased synthesis of glutathione, impaired activity of mitochondrial respiratory chain complexes, and increased rate of apoptosis (20-25). The affects of cystinosis are not isolated to the kidney. Patients also can also exhibit photophobia due to corneal cystine crystals, retinal depigmentation by 7 years that can evolve into blindness between 13 and 40 years, diabetes mellitus, portal hypertension, hypothyroidism, exocrine pancreatic insufficiency, and hypogonadism as well as muscular and central nervous system complications [(26-28); reviewed in (5)]. Late-onset juvenile and ocular nonnephropathic (OMIM: #219750) cystinosis are less severe and less frequent forms of cystinosis [reviewed in (5)]. Late-onset juvenile cystinosis manifests between 12 and 15 years of age with photophobia and renal impairment, but patients do not suffer from severe tubulophathy or growth retardation [reviewed in (5)]. Progression to end-stage renal failure is slow in patients with juvenile cystinosis and is reached at variable ages [reviewed in (5)]. Patients with ocular cystinosis do not have renal abnormalities, but exhibit corneal crystals with or without photophobia (29;30).

The most common CTNS mutation that has been observed in patients with cystinosis is a 57 kb deletion that removes the 5’ region of the gene upstream of, and including, exon 10 (2;31). Most of the CTNS mutations associated with infantile cystinosis are loss of function mutations; point mutations, usually found in a cluster in the last three transmembrane domains, can also cause infantile cystinosis, more than likely due to changes in the structure of the CTNS protein [reviewed in (5)].  Point mutations found within the inter-transmembrane loops or in the N-terminal region are typically linked to the milder forms of cystinosis (32). These ‘mild’ mutations cause loss of function in CTNS, but some residual activity (9%-20%) remains (30). Three mutations have been described in the CTNS promoter region extending 316 bp ukpstream of the start codon in exon 1, leading to reduced promoter activity (33). Patients with infantile cystinosis carry ‘severe’ mutations on both alleles, while patients with milder forms of cystinosis have either one ‘severe’ and one ‘mild’ mutation, or two ‘mild’ mutations (33).

CTNS functions in melanogenesis to regulate skin and hair pigmentation (8). Silencing of Cnts inhibits the expression of the tyrosinase protein (Tyr; see the record for ghost), a phenoloxidase that initiates the synthesis of melanin; expression of other essential melanin proteins Tyrp1 (see the record for chi) and DCT were not significantly affected (8). Upon siRNA-mediated knockdown of Ctns expression, Tyr expression was not changed indicating that that the loss of CTNS function regulated Tyr expression at a post-transcriptional level (8). Similar to its function in lysosomes, CTNS functions to regulate melanosomal H⁺ levels to subsequently regulate melanin synthesis (8). Therefore, CTNS-mediated acidification of the melanosome could disrupt Tyr trafficking leading to its retention in the early secretory pathway (34) and/or mediate Tyr degradation by lysosomal proteases (35). However, examination of Ctns-deficient cells determined that the routing of Tyr before the medial Golgi network was not disrupted, suggesting that CTNS-mediated acidification of the melanosome promoted Tyr degradation by lysosomal proteases (8). Caucasian patients with cystinosis exhibit hypopigmentation (i.e., blond hair, blue eyes, and a light complexion); African-American patients have no hypopigmentation (36). Examination of the melanin content and the composition of the patients’ hair determined that there was a decrease in eumelanin and an increase in pheomelanin (8;35).

The last four exons of murine Ctns (encoding the last five transmembrane domains) were replaced by an IRES-βgal-neo cassette to generate a Cnts null mouse model [Cnts^-/-; MGI:2388945; (1)]. The mutant Cnts construct produced a truncated, nonfunctional CTNS protein that mislocalized to the plasma membrane (1). Plasma from Ctns^-/- mice had significantly more cystine compared to wild type and Cnts^+/- mice. Microscopic examination of a 24-week-old Ctns^-/- mouse found cystine crystals in interstitial cells of various organs including testis, thyroid, salivary glands, and lymph nodes as well as in some Küppfer cells and a few in proximal tubular cells (1). At 35 weeks, crystal accumulation was irregular in Küppfer cells and absent in hepatocytes (1). Several Küppfer cells formed dark cells after osmium fixation, a feature unique to cystinosis (1;37). Isolated renal lesions were observed in younger mice, however, progression of the lesions was not observed in older mice (1). At 35 weeks, cystine crystals were observed in the melanocytes of the conjunctiva and in choroidal and scleral interstitial cells; this distribution of the crystals persisted with age (1). At 6 to 8 months, the Cnts^-/- mice were less active than the wild type and heterozygous controls (1). In addition, the Cnts^-/- mice exhibited a delayed onset of movement in an open-field test and a need to walk backwards and along the walls (i.e., an increased anxiety-related response) (1). The Cnts^-/- mice had decreased bone mineralization compared to the wild type controls as well as bone deformity of the tibia and femur and osteoporosis of the compact bone of the diaphysis (1). In a 1-year-old Cnts^-/- mouse with severe muscular impairment, cystine crystals were observed in the interstitial cells of the skeletal muscle and were associated with myocyte necrosis; no abnormality was detected in three other mice with comparable ages (1). In the mice with no muscular impairment, crystals were observed in the spleen and lymph nodes, the interstitial cells of the heart (but not the myocytes) as well as in the interstitial cells of the thyroid, pancreas, ovaries, uterus, testis, and salivary glands (1). Crystals were not observed in the corresponding epithelia or myocytes of the skeletal muscle and heart and none of the organs showed signs of structural abnormalities (1). At 1.5 years, Cnts^-/- mice did not exhibit tubulopathy or renal failure (1). No significant differences were noted between the Cnts^-/- and wild type mice in plasma levels of creatinine, urea, bicarbonatemia, uric acid, calcium, phosphate, or alkaline phosphatase (1). In addition, the urine of the Cnts^-/- mice did not have elevated proteinuria, glycosuria, phosphaturia, calciuria, or aminoaciduria compared to controls (1). The Cnts^-/- mice did not exhibit signs of diabetes or hypothyroidism (1). Examination of the Cnts^-/- mouse determined that the mice did not develop early onset kidney failure characteristic of infantile cystinosis (8). However, on the C57BL/6 background, the loss of Cnts expression resulted in progressive chronic renal failure (38).

Examination of retinal function by electroretinogram (ERG) determined that at 8-months, the Cnts^-/- mice exhibited abnormal scotopic and photopic responses when compared to the wild type controls (1). One Cnts^-/- mouse exhibited a “supernormal” ERG profile compared to the controls; the other mouse examined exhibited reduced amplitude (1). The mouse with impaired ERG also exhibited patches of depigmentation in the peripheral retina that were not observed in the controls (1). The phenotypic variability was proposed to be due to the mixed genetic background (129Sv x C57BL/6) of the mice. Cnts^-/- mice on a pure C57BL/6 background were generated and the ocular anomalies in the mice were examined (30). Cystine levels were elevated in the iris (and ciliary body), cornea, retina, and in the lens of the Cnts^-/- mice compared to the controls (30).

Cnts^-/- mice in both the C57BL/6 (non-agouti) or C57BL/6 x 129sV (agouti) background did not exhibit hair pigmentation dilution (8). Eumelanin content was comparable in the Cnts null models on both genetic backgrounds to the wild type control (8). In contrast, both Cnts null models exhibited an increase in pheomelanin content compared to controls (8). 

Putative Mechanism

Mutation of amino acid 299 may cause disruption​ in the structure of the PQ-loop motif and the sixth transmembrane domain. As the structure of the YFPQA motif, within the PQ-loop consensus sequence, is essential for proper localization of CNTS, it is possible that the I299M mutation is leading to disruption in the localization of CNTS. Alternatively, or in conjunction with, Asp305, within the sixth transmembrane domain is a proton binding site cooperatively coupled to cystine binding (4). Changes in the conformation of the sixth transmembrane domain due to the I299M mutation may alter the accessiblity of Asp305 to protons, therefore leading to abolished, or reduced, transient currents.

References

  1. Cherqui, S., Sevin, C., Hamard, G., Kalatzis, V., Sich, M., Pequignot, M. O., Gogat, K., Abitbol, M., Broyer, M., Gubler, M. C., and Antignac, C. (2002) Intralysosomal Cystine Accumulation in Mice Lacking Cystinosin, the Protein Defective in Cystinosis. Mol Cell Biol. 22, 7622-7632.

  2. Town, M., Jean, G., Cherqui, S., Attard, M., Forestier, L., Whitmore, S. A., Callen, D. F., Gribouval, O., Broyer, M., Bates, G. P., van't Hoff, W., and Antignac, C. (1998) A Novel Gene Encoding an Integral Membrane Protein is Mutated in Nephropathic Cystinosis. Nat Genet. 18, 319-324.

  3. Cherqui, S., Kalatzis, V., Trugnan, G., and Antignac, C. (2001) The Targeting of Cystinosin to the Lysosomal Membrane Requires a Tyrosine-Based Signal and a Novel Sorting Motif. J Biol Chem. 276, 13314-13321.

  4. Ruivo, R., Bellenchi, G. C., Chen, X., Zifarelli, G., Sagne, C., Debacker, C., Pusch, M., Supplisson, S., and Gasnier, B. (2012) Mechanism of proton/substrate Coupling in the Heptahelical Lysosomal Transporter Cystinosin. Proc Natl Acad Sci U S A. 109, E210-7.

  5. Kalatzis, V., and Antignac, C. (2002) Cystinosis: From Gene to Disease. Nephrol Dial Transplant. 17, 1883-1886.

  6. Ponting, C. P., Mott, R., Bork, P., and Copley, R. R. (2001) Novel Protein Domains and Repeats in Drosophila Melanogaster: Insights into Structure, Function, and Evolution. Genome Res. 11, 1996-2008.

  7. Taranta, A., Petrini, S., Palma, A., Mannucci, L., Wilmer, M. J., De Luca, V., Diomedi-Camassei, F., Corallini, S., Bellomo, F., van den Heuvel, L. P., Levtchenko, E. N., and Emma, F. (2008) Identification and Subcellular Localization of a New Cystinosin Isoform. Am J Physiol Renal Physiol. 294, F1101-8.

  8. Chiaverini, C., Sillard, L., Flori, E., Ito, S., Briganti, S., Wakamatsu, K., Fontas, E., Berard, E., Cailliez, M., Cochat, P., Foulard, M., Guest, G., Niaudet, P., Picardo, M., Bernard, F. X., Antignac, C., Ortonne, J. P., and Ballotti, R. (2012) Cystinosin is a Melanosomal Protein that Regulates Melanin Synthesis. FASEB J. 26, 3779-3789.

  9. Bellomo, F., Corallini, S., Pastore, A., Palma, A., Laurenzi, C., Emma, F., and Taranta, A. (2010) Modulation of CTNS Gene Expression by Intracellular Thiols. Free Radic Biol Med. 48, 865-872.

  10. Corallini, S., Taranta, A., Bellomo, F., Palma, A., Pastore, A., and Emma, F. (2011) Transcriptional and Posttranscriptional Regulation of the CTNS Gene. Pediatr Res. 70, 130-135.

  11. Jones, D. P. (2008) Radical-Free Biology of Oxidative Stress. Am J Physiol Cell Physiol. 295, C849-68.

  12. Haq, M. R., Kalatzis, V., Gubler, M. C., Town, M. M., Antignac, C., Van't Hoff, W. G., and Woolf, A. S. (2002) Immunolocalization of Cystinosin, the Protein Defective in Cystinosis. J Am Soc Nephrol. 13, 2046-2051.

  13. Janssen-Heininger, Y. M., Mossman, B. T., Heintz, N. H., Forman, H. J., Kalyanaraman, B., Finkel, T., Stamler, J. S., Rhee, S. G., and van der Vliet, A. (2008) Redox-Based Regulation of Signal Transduction: Principles, Pitfalls, and Promises. Free Radic Biol Med. 45, 1-17.

  14. Thoene, J. G., Oshima, R. G., Ritchie, D. G., and Schneider, J. A. (1977) Cystinotic Fibroblasts Accumulate Cystine from Intracellular Protein Degradation. Proc Natl Acad Sci U S A. 74, 4505-4507.

  15. Oshima, R. G., Rhead, W. J., Thoene, J. G., and Schneider, J. A. (1976) Cystine Metabolism in Human Fibroblasts. Comparison of Normal, Cystinotic, and Gamma-Glutamylcysteine Synethetase-Deficient Cells. J Biol Chem. 251, 4287-4293.

  16. Kalatzis, V., Cherqui, S., Antignac, C., and Gasnier, B. (2001) Cystinosin, the Protein Defective in Cystinosis, is a H(+)-Driven Lysosomal Cystine Transporter. EMBO J. 20, 5940-5949.

  17. Gahl, W. A., Schneider, J. A., and Aula, P. P. (1995) Lysosomal Transport Disorders: Cystinosis and Sialic Acid Storage Disorders, in The Metabolic and Molecular Basis of Inherited Disease (C. R. Scriver, A. L. Beaudet, W. S. Sly, and D. Valle, Eds.) pp 3763-3797, McGraw‐Hill, New York.

  18. Schneider, J. A., Bradley, K., and Seegmiller, J. E. (1967) Increased Cystine in Leukocytes from Individuals Homozygous and Heterozygous for Cystinosis. Science. 157, 1321-1322.

  19. Bois, E., Feingold, J., Frenay, P., and Briard, M. L. (1976) Infantile Cystinosis in France: Genetics, Incidence, Geographic Distribution. J Med Genet. 13, 434-438.

  20. Levtchenko, E., de Graaf-Hess, A., Wilmer, M., van den Heuvel, L., Monnens, L., and Blom, H. (2005) Altered Status of Glutathione and its Metabolites in Cystinotic Cells. Nephrol Dial Transplant. 20, 1828-1832.

  21. Levtchenko, E. N., Wilmer, M. J., Janssen, A. J., Koenderink, J. B., Visch, H. J., Willems, P. H., de Graaf-Hess, A., Blom, H. J., van den Heuvel, L. P., and Monnens, L. A. (2006) Decreased Intracellular ATP Content and Intact Mitochondrial Energy Generating Capacity in Human Cystinotic Fibroblasts. Pediatr Res. 59, 287-292.

  22. Laube, G. F., Shah, V., Stewart, V. C., Hargreaves, I. P., Haq, M. R., Heales, S. J., and van't Hoff, W. G. (2006) Glutathione Depletion and Increased Apoptosis Rate in Human Cystinotic Proximal Tubular Cells. Pediatr Nephrol. 21, 503-509.

  23. Park, M. A., Pejovic, V., Kerisit, K. G., Junius, S., and Thoene, J. G. (2006) Increased Apoptosis in Cystinotic Fibroblasts and Renal Proximal Tubule Epithelial Cells Results from Cysteinylation of Protein Kinase Cdelta. J Am Soc Nephrol. 17, 3167-3175.

  24. Mannucci, L., Pastore, A., Rizzo, C., Piemonte, F., Rizzoni, G., and Emma, F. (2006) Impaired Activity of the Gamma-Glutamyl Cycle in Nephropathic Cystinosis Fibroblasts. Pediatr Res. 59, 332-335.

  25. Park, M. A., and Thoene, J. G. (2005) Potential Role of Apoptosis in Development of the Cystinotic Phenotype. Pediatr Nephrol. 20, 441-446.

  26. Theodoropoulos, D. S., Krasnewich, D., Kaiser-Kupfer, M. I., and Gahl, W. A. (1993) Classic Nephropathic Cystinosis as an Adult Disease. JAMA. 270, 2200-2204.

  27. Gahl, W. A., and Kaiser-Kupfer, M. I. (1987) Complications of Nephropathic Cystinosis After Renal Failure. Pediatr Nephrol. 1, 260-268.

  28. Gahl, W. A., Thoene, J. G., and Schneider, J. A. (2002) Cystinosis. N Engl J Med. 347, 111-121.

  29. Gahl, W. A., Kuehl, E. M., Iwata, F., Lindblad, A., and Kaiser-Kupfer, M. I. (2000) Corneal Crystals in Nephropathic Cystinosis: Natural History and Treatment with Cysteamine Eyedrops. Mol Genet Metab. 71, 100-120.

  30. Kalatzis, V., Serratrice, N., Hippert, C., Payet, O., Arndt, C., Cazevieille, C., Maurice, T., Hamel, C., Malecaze, F., Antignac, C., Muller, A., and Kremer, E. J. (2007) The Ocular Anomalies in a Cystinosis Animal Model Mimic Disease Pathogenesis. Pediatr Res. 62, 156-162.

  31. Forestier, L., Jean, G., Attard, M., Cherqui, S., Lewis, C., van't Hoff, W., Broyer, M., Town, M., and Antignac, C. (1999) Molecular Characterization of CTNS Deletions in Nephropathic Cystinosis: Development of a PCR-Based Detection Assay. Am J Hum Genet. 65, 353-359.

  32. Attard, M., Jean, G., Forestier, L., Cherqui, S., van't Hoff, W., Broyer, M., Antignac, C., and Town, M. (1999) Severity of Phenotype in Cystinosis Varies with Mutations in the CTNS Gene: Predicted Effect on the Model of Cystinosin. Hum Mol Genet. 8, 2507-2514.

  33. Phornphutkul, C., Anikster, Y., Huizing, M., Braun, P., Brodie, C., Chou, J. Y., and Gahl, W. A. (2001) The Promoter of a Lysosomal Membrane Transporter Gene, CTNS, Binds Sp-1, Shares Sequences with the Promoter of an Adjacent Gene, CARKL, and Causes Cystinosis if Mutated in a Critical Region. Am J Hum Genet. 69, 712-721.

  34. Halaban, R., Patton, R. S., Cheng, E., Svedine, S., Trombetta, E. S., Wahl, M. L., Ariyan, S., and Hebert, D. N. (2002) Abnormal Acidification of Melanoma Cells Induces Tyrosinase Retention in the Early Secretory Pathway. J Biol Chem. 277, 14821-14828.

  35. Watabe, H., Valencia, J. C., Yasumoto, K., Kushimoto, T., Ando, H., Muller, J., Vieira, W. D., Mizoguchi, M., Appella, E., and Hearing, V. J. (2004) Regulation of Tyrosinase Processing and Trafficking by Organellar pH and by Proteasome Activity. J Biol Chem. 279, 7971-7981.

  36. Guillet, G., Sassolas, B., Fromentoux, S., Gobin, E., and Leroy, J. P. (1998) Skin Storage of Cystine and Premature Skin Ageing in Cystinosis. Lancet. 352, 1444-1445.

  37. Spear, G. S., Slusser, R. J., Tousimis, A. J., Taylor, C. G., and Schulman, J. D. (1971) Cystinosis. an Ultrastructural and Electron-Probe Study of the Kidney with Unusual Findings. Arch Pathol. 91, 206-221.

  38. Nevo, N., Chol, M., Bailleux, A., Kalatzis, V., Morisset, L., Devuyst, O., Gubler, M. C., and Antignac, C. (2010) Renal Phenotype of the Cystinosis Mouse Model is Dependent upon Genetic Background. Nephrol Dial Transplant. 25, 1059-1066.