Mutagenetix > Incidental Mutation

Incidental Mutation 'R4614:Otogl'

344961

Institutional Source

Beutler Lab

Gene Symbol

Otogl

Ensembl Gene

ENSMUSG00000091455

Gene Name

otogelin-like

Synonyms

Gm6924

MMRRC Submission

041825-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4614 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

107760531-107912134 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

A to T at 107892124 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Stop codon at position 245 (C245*)

Ref Sequence

ENSEMBL: ENSMUSP00000129467 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000165341]

AlphaFold

F7A4A7

Predicted Effect

probably null
Transcript: ENSMUST00000165341
AA Change: C245*

SMART Domains

Protein: ENSMUSP00000129467
Gene: ENSMUSG00000091455
AA Change: C245*

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
EGF_like	71	101	3.36e1	SMART
VWD	104	264	4.74e-29	SMART
C8	305	378	6.13e-6	SMART
VWD	463	625	7e-41	SMART
C8	668	733	3.6e-3	SMART
Pfam:TIL	736	791	2.3e-11	PFAM
SCOP:d1coua_	833	911	1e-6	SMART
VWD	928	1085	1.29e-30	SMART
C8	1120	1194	1.81e-26	SMART
Pfam:AbfB	1230	1350	1.2e-10	PFAM
Pfam:TIL	1364	1418	6.1e-8	PFAM
VWD	1497	1671	2.34e-10	SMART
C8	1705	1775	9.56e-17	SMART
Pfam:TIL	1778	1836	1.6e-8	PFAM
low complexity region	1870	1886	N/A	INTRINSIC
CT	2242	2325	6.9e-14	SMART

Meta Mutation Damage Score

0.9717

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.3%
20x: 95.2%

Validation Efficiency

98% (95/97)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the otogelin family. This gene is expressed in the inner ear of vertebrates with the highest level of expression seen at the embryonic stage and lowest in adult. Knockdown studies in zebrafish suggest that this gene is essential for normal inner ear function. Mutations in this gene are associated with autosomal recessive deafness. [provided by RefSeq, Dec 2012]

Allele List at MGI

Other mutations in this stock

Total: 88 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2210408I21Rik	T	G	13: 77,254,256		probably null	Het
4932414N04Rik	C	A	2: 68,745,460	T701K	probably benign	Het
6030419C18Rik	AGAGGAGGAGGAGGAGG	AGAGGAGGAGGAGG	9: 58,499,432		probably benign	Het
Abcb11	A	T	2: 69,284,681	H640Q	possibly damaging	Het
Ago2	C	T	15: 73,130,967	V139M	probably damaging	Het
Apol11a	A	T	15: 77,516,572	K86N	probably benign	Het
Ass1	T	C	2: 31,514,783	Y359H	probably damaging	Het
Bpifa3	A	T	2: 154,136,280	N34I	probably damaging	Het
Brwd1	A	T	16: 96,047,359	L540H	probably damaging	Het
C3ar1	G	A	6: 122,850,721	S179F	probably benign	Het
Ccnb1ip1	T	C	14: 50,792,195	T137A	probably benign	Het
Cd5l	A	G	3: 87,368,619	T299A	probably benign	Het
Cdk12	T	A	11: 98,249,777		probably benign	Het
Cep290	T	C	10: 100,508,740	M480T	probably benign	Het
Cep290	G	A	10: 100,559,687	R2112K	possibly damaging	Het
Chn2	G	A	6: 54,290,403	M292I	probably damaging	Het
Cic	TCCCCC	TCCCCCCC	7: 25,291,670		probably null	Het
Cpeb1	A	T	7: 81,436,270	D41E	possibly damaging	Het
Csf2rb2	C	G	15: 78,291,702	C184S	probably damaging	Het
Ctsc	G	A	7: 88,278,375		probably null	Het
Cyp2c40	G	A	19: 39,803,856	S191L	probably damaging	Het
Dagla	T	C	19: 10,248,277	E841G	probably damaging	Het
Dld	A	T	12: 31,333,945	Y386*	probably null	Het
Dpp8	G	A	9: 65,066,396	S634N	probably benign	Het
Duox2	A	T	2: 122,289,557	V824E	probably damaging	Het
Dync2h1	A	C	9: 7,011,290	S3634R	probably benign	Het
Eef1d	T	C	15: 75,903,576	N78S	probably benign	Het
Fcrl5	T	A	3: 87,448,426	I482N	probably damaging	Het
Fezf1	A	T	6: 23,247,858	C73S	possibly damaging	Het
Fgfr1	A	G	8: 25,557,797	D53G	probably benign	Het
Fmn1	T	C	2: 113,365,149	L398S	unknown	Het
Gm17175	T	C	14: 51,571,585	Q108R	probably benign	Het
Gm28042	G	A	2: 120,041,158	G669D	probably damaging	Het
Gm6185	A	G	1: 161,223,099		noncoding transcript	Het
Gucy2g	A	T	19: 55,202,147	C1018*	probably null	Het
H2-Q10	A	T	17: 35,474,020		probably benign	Het
H2-T22	T	G	17: 36,040,537	Q267P	probably benign	Het
Hibadh	A	G	6: 52,546,930	Y328H	possibly damaging	Het
Hsd3b3	T	A	3: 98,742,080	Y309F	probably benign	Het
Ighv1-37	C	T	12: 114,896,243	A116T	probably benign	Het
Ighv1-82	T	C	12: 115,952,660	T77A	probably benign	Het
Igkv8-21	A	T	6: 70,315,157	S34T	probably benign	Het
Iqch	A	G	9: 63,482,581	M733T	probably benign	Het
Jakmip2	T	A	18: 43,562,592	D539V	probably damaging	Het
Lgi2	A	G	5: 52,538,433	S395P	probably damaging	Het
Lrrc40	A	T	3: 158,054,634	N344I	probably damaging	Het
Ltbp1	G	A	17: 75,289,994		probably benign	Het
Metap1d	C	T	2: 71,524,948	P332L	probably benign	Het
Mfap4	C	A	11: 61,485,509		probably benign	Het
Mis18bp1	T	A	12: 65,153,529		probably benign	Het
Mta2	T	C	19: 8,948,128		probably null	Het
Mtmr4	T	C	11: 87,610,935	L548S	probably damaging	Het
Muc4	A	G	16: 32,757,058	K241E	probably benign	Het
Mup18	T	A	4: 61,671,917	I125F	possibly damaging	Het
Nfs1	A	G	2: 156,144,050	S31P	probably benign	Het
Olfr38	G	T	6: 42,762,418	R122L	probably benign	Het
Olfr419	A	G	1: 174,250,622	F102L	possibly damaging	Het
Olfr981	T	A	9: 40,022,959	C189S	probably damaging	Het
Pcdhb16	G	A	18: 37,480,345	G786D	probably benign	Het
Pdcd5	C	T	7: 35,647,047		probably benign	Het
Phkg2	C	T	7: 127,577,620	R61W	probably damaging	Het
Piezo1	A	T	8: 122,486,411	I1871N	probably benign	Het
Pkd2l1	C	A	19: 44,154,134	A490S	probably damaging	Het
Plxnd1	T	C	6: 115,972,525	T767A	possibly damaging	Het
Polr3c	T	G	3: 96,716,471	I322L	probably benign	Het
Ppp1r26	C	A	2: 28,450,848	H163Q	probably benign	Het
Prox1	T	G	1: 190,162,008	Y80S	probably damaging	Het
Pygl	T	C	12: 70,210,979		probably null	Het
Rab23	T	C	1: 33,739,385	V236A	probably benign	Het
Setd2	T	C	9: 110,569,813		probably null	Het
Slc5a7	A	G	17: 54,276,559	S568P	probably benign	Het
Smpd3	A	G	8: 106,259,739	L477P	probably damaging	Het
Spg21	A	G	9: 65,480,389		probably null	Het
Spta1	A	T	1: 174,192,977	I551F	probably damaging	Het
Supt5	A	T	7: 28,325,972	I135N	possibly damaging	Het
Tacstd2	A	G	6: 67,535,186	F174S	probably damaging	Het
Tas1r2	A	T	4: 139,659,787	T186S	probably damaging	Het
Tie1	A	G	4: 118,479,051	Y673H	probably damaging	Het
Tom1l1	A	T	11: 90,671,126	N190K	probably damaging	Het
Tox2	T	C	2: 163,320,647	L479P	probably damaging	Het
Tox4	C	T	14: 52,287,467	T249I	probably damaging	Het
Trmt1l	C	T	1: 151,454,048	Q581*	probably null	Het
Vmn1r49	A	G	6: 90,072,552	V156A	probably benign	Het
Vmn2r13	A	T	5: 109,175,199	F75I	probably benign	Het
Washc2	T	A	6: 116,238,174	S502T	possibly damaging	Het
Wnk4	A	T	11: 101,274,111	E755D	probably benign	Het
Zfp207	T	A	11: 80,395,190		probably benign	Het
Zfp352	A	G	4: 90,225,081	K486R	probably benign	Het

Other mutations in Otogl

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
H8562:Otogl	UTSW	10	107910956	missense	probably benign	0.00
R0084:Otogl	UTSW	10	107901341	missense	probably damaging	0.96
R0164:Otogl	UTSW	10	107874530	missense	probably damaging	0.97
R0164:Otogl	UTSW	10	107874530	missense	probably damaging	0.97
R0238:Otogl	UTSW	10	107806696	missense	probably damaging	0.98
R0238:Otogl	UTSW	10	107806696	missense	probably damaging	0.98
R0239:Otogl	UTSW	10	107806696	missense	probably damaging	0.98
R0239:Otogl	UTSW	10	107806696	missense	probably damaging	0.98
R0294:Otogl	UTSW	10	107777228	missense	probably damaging	1.00
R0360:Otogl	UTSW	10	107770650	splice site	probably benign
R0442:Otogl	UTSW	10	107876855	missense	probably damaging	1.00
R0488:Otogl	UTSW	10	107803605	missense	probably benign	0.02
R0507:Otogl	UTSW	10	107866740	missense	possibly damaging	0.51
R0573:Otogl	UTSW	10	107780988	missense	probably benign	0.00
R0581:Otogl	UTSW	10	107789040	missense	possibly damaging	0.79
R0613:Otogl	UTSW	10	107817070	missense	probably damaging	0.99
R0614:Otogl	UTSW	10	107798355	missense	probably benign	0.14
R0742:Otogl	UTSW	10	107866740	missense	possibly damaging	0.51
R0846:Otogl	UTSW	10	107772296	missense	probably benign	0.40
R1146:Otogl	UTSW	10	107886513	missense	probably damaging	1.00
R1146:Otogl	UTSW	10	107886513	missense	probably damaging	1.00
R1439:Otogl	UTSW	10	107779252	missense	probably benign	0.02
R1457:Otogl	UTSW	10	107878152	splice site	probably null
R1526:Otogl	UTSW	10	107869526	missense	probably damaging	1.00
R1662:Otogl	UTSW	10	107798357	missense	possibly damaging	0.84
R1664:Otogl	UTSW	10	107806576	missense	probably benign	0.00
R1667:Otogl	UTSW	10	107813965	nonsense	probably null
R1695:Otogl	UTSW	10	107814017	missense	probably damaging	0.99
R1731:Otogl	UTSW	10	107817111	missense	probably damaging	1.00
R1733:Otogl	UTSW	10	107783712	missense	possibly damaging	0.46
R1764:Otogl	UTSW	10	107899461	nonsense	probably null
R1824:Otogl	UTSW	10	107779831	missense	probably benign
R1850:Otogl	UTSW	10	107878064	missense	probably damaging	1.00
R1856:Otogl	UTSW	10	107854264	missense	possibly damaging	0.92
R1875:Otogl	UTSW	10	107899590	missense	probably damaging	1.00
R1938:Otogl	UTSW	10	107777575	missense	probably damaging	0.98
R1986:Otogl	UTSW	10	107794190	critical splice acceptor site	probably null
R2072:Otogl	UTSW	10	107781043	missense	probably damaging	1.00
R2117:Otogl	UTSW	10	107858918	missense	probably benign	0.06
R2219:Otogl	UTSW	10	107856977	missense	probably damaging	1.00
R2508:Otogl	UTSW	10	107874500	missense	probably damaging	0.99
R2883:Otogl	UTSW	10	107768981	missense	probably damaging	1.00
R2931:Otogl	UTSW	10	107820004	missense	possibly damaging	0.85
R3620:Otogl	UTSW	10	107874371	missense	probably damaging	0.99
R3621:Otogl	UTSW	10	107874371	missense	probably damaging	0.99
R3735:Otogl	UTSW	10	107899529	nonsense	probably null
R3812:Otogl	UTSW	10	107899471	missense	probably damaging	1.00
R3880:Otogl	UTSW	10	107827704	missense	probably damaging	0.96
R3958:Otogl	UTSW	10	107821925	missense	probably damaging	1.00
R4063:Otogl	UTSW	10	107790649	missense	probably benign	0.02
R4064:Otogl	UTSW	10	107790649	missense	probably benign	0.02
R4108:Otogl	UTSW	10	107771244	missense	probably benign	0.01
R4352:Otogl	UTSW	10	107869535	missense	probably damaging	1.00
R4526:Otogl	UTSW	10	107886980	missense	probably damaging	1.00
R4703:Otogl	UTSW	10	107821924	missense	probably damaging	1.00
R4741:Otogl	UTSW	10	107779260	missense	probably benign	0.00
R4790:Otogl	UTSW	10	107822033	critical splice acceptor site	probably null
R4801:Otogl	UTSW	10	107901336	missense	probably damaging	1.00
R4802:Otogl	UTSW	10	107901336	missense	probably damaging	1.00
R4910:Otogl	UTSW	10	107879517	missense	probably benign	0.05
R4913:Otogl	UTSW	10	107876855	missense	probably damaging	0.98
R5238:Otogl	UTSW	10	107768973	missense	probably damaging	1.00
R5261:Otogl	UTSW	10	107777592	missense	probably benign	0.16
R5387:Otogl	UTSW	10	107780933	missense	probably benign	0.03
R5395:Otogl	UTSW	10	107817138	missense	probably benign	0.39
R5403:Otogl	UTSW	10	107808756	missense	probably benign	0.08
R5482:Otogl	UTSW	10	107821941	missense	probably damaging	0.99
R5547:Otogl	UTSW	10	107782048	missense	possibly damaging	0.55
R5611:Otogl	UTSW	10	107786769	missense	probably damaging	1.00
R5642:Otogl	UTSW	10	107886552	missense	probably benign	0.44
R5690:Otogl	UTSW	10	107777117	synonymous	silent
R5711:Otogl	UTSW	10	107777117	synonymous	silent
R5731:Otogl	UTSW	10	107881464	missense	probably damaging	0.98
R5743:Otogl	UTSW	10	107857001	missense	possibly damaging	0.67
R5782:Otogl	UTSW	10	107777117	synonymous	silent
R5820:Otogl	UTSW	10	107777117	synonymous	silent
R5897:Otogl	UTSW	10	107777117	synonymous	silent
R6004:Otogl	UTSW	10	107879529	missense	probably damaging	1.00
R6145:Otogl	UTSW	10	107777117	synonymous	silent
R6146:Otogl	UTSW	10	107777117	synonymous	silent
R6147:Otogl	UTSW	10	107777117	synonymous	silent
R6149:Otogl	UTSW	10	107881453	missense	probably benign	0.36
R6226:Otogl	UTSW	10	107771206	nonsense	probably null
R6283:Otogl	UTSW	10	107790500	missense	probably damaging	0.98
R6414:Otogl	UTSW	10	107782050	missense	probably damaging	1.00
R6604:Otogl	UTSW	10	107822034	splice site	probably null
R6634:Otogl	UTSW	10	107862304	missense	probably damaging	1.00
R6727:Otogl	UTSW	10	107777117	synonymous	silent
R6755:Otogl	UTSW	10	107853303	nonsense	probably null
R6795:Otogl	UTSW	10	107777117	synonymous	silent
R6797:Otogl	UTSW	10	107777117	synonymous	silent
R6864:Otogl	UTSW	10	107827806	missense	probably damaging	0.96
R6924:Otogl	UTSW	10	107808641	missense	probably damaging	1.00
R6967:Otogl	UTSW	10	107814050	missense	probably benign	0.01
R7000:Otogl	UTSW	10	107779831	missense	probably benign
R7075:Otogl	UTSW	10	107778929	missense	probably benign	0.16
R7122:Otogl	UTSW	10	107866654	missense	probably benign	0.08
R7176:Otogl	UTSW	10	107778911	missense	probably damaging	1.00
R7184:Otogl	UTSW	10	107763200	missense	probably damaging	1.00
R7199:Otogl	UTSW	10	107874533	missense	possibly damaging	0.88
R7252:Otogl	UTSW	10	107821943	missense	probably benign	0.06
R7286:Otogl	UTSW	10	107770610	missense	probably benign	0.00
R7373:Otogl	UTSW	10	107901251	missense	probably damaging	1.00
R7449:Otogl	UTSW	10	107803663	missense	probably damaging	1.00
R7486:Otogl	UTSW	10	107821988	missense	probably damaging	1.00
R7493:Otogl	UTSW	10	107886982	missense	probably benign	0.06
R7659:Otogl	UTSW	10	107777120	missense	probably benign	0.19
R7732:Otogl	UTSW	10	107806664	missense	probably benign	0.01
R7754:Otogl	UTSW	10	107869546	missense	probably damaging	0.99
R7757:Otogl	UTSW	10	107876921	missense	probably damaging	1.00
R7800:Otogl	UTSW	10	107886515	missense	probably damaging	0.99
R7864:Otogl	UTSW	10	107869567	missense	probably damaging	1.00
R7879:Otogl	UTSW	10	107777109	missense	probably benign	0.00
R7941:Otogl	UTSW	10	107806802	splice site	probably null
R7956:Otogl	UTSW	10	107878026	missense	possibly damaging	0.62
R7988:Otogl	UTSW	10	107895776	missense	probably damaging	1.00
R8057:Otogl	UTSW	10	107808615	missense	probably benign	0.00
R8058:Otogl	UTSW	10	107762426	missense	probably damaging	1.00
R8127:Otogl	UTSW	10	107895752	missense	probably damaging	1.00
R8143:Otogl	UTSW	10	107806666	missense	probably damaging	1.00
R8310:Otogl	UTSW	10	107777600	missense	possibly damaging	0.94
R8319:Otogl	UTSW	10	107853266	critical splice donor site	probably null
R8339:Otogl	UTSW	10	107789535	missense	probably damaging	0.99
R8339:Otogl	UTSW	10	107789536	missense	probably benign	0.34
R8394:Otogl	UTSW	10	107886465	critical splice donor site	probably null
R8428:Otogl	UTSW	10	107798736	missense	probably damaging	1.00
R8444:Otogl	UTSW	10	107857114	missense	probably benign	0.01
R8501:Otogl	UTSW	10	107790560	missense	probably benign
R8503:Otogl	UTSW	10	107892126	missense	probably damaging	1.00
R8680:Otogl	UTSW	10	107912075	critical splice donor site	probably null
R9025:Otogl	UTSW	10	107777571	missense	probably damaging	0.99
R9090:Otogl	UTSW	10	107817113	missense	probably null	0.99
R9223:Otogl	UTSW	10	107854344	missense	probably damaging	0.99
R9268:Otogl	UTSW	10	107781056	missense	probably damaging	1.00
R9271:Otogl	UTSW	10	107817113	missense	probably null	0.99
R9356:Otogl	UTSW	10	107782029	missense	probably damaging	1.00
R9484:Otogl	UTSW	10	107822033	critical splice acceptor site	probably null
R9484:Otogl	UTSW	10	107901295	missense	probably damaging	1.00
R9571:Otogl	UTSW	10	107762503	missense	possibly damaging	0.94
R9731:Otogl	UTSW	10	107899467	missense	probably damaging	1.00
X0065:Otogl	UTSW	10	107895782	missense	probably damaging	1.00
X0067:Otogl	UTSW	10	107866677	missense	probably damaging	1.00
Z1176:Otogl	UTSW	10	107777213	missense	probably benign
Z1176:Otogl	UTSW	10	107778873	missense	probably damaging	0.97
Z1176:Otogl	UTSW	10	107789032	missense	probably benign	0.00
Z1177:Otogl	UTSW	10	107763258	nonsense	probably null
Z1177:Otogl	UTSW	10	107853397	missense	possibly damaging	0.78
Z1177:Otogl	UTSW	10	107876903	missense	probably benign	0.14

Predicted Primers

PCR Primer
(F):5'- AACTGGACAAATGGCAGCC -3'
(R):5'- TGATCTTGAGAACACGCCACAC -3'

Sequencing Primer
(F):5'- AATGGCAGCCACGGACTTTC -3'
(R):5'- GCCACACGTAACTTTAACTTGG -3'

Posted On

2015-09-25