Incidental Mutation 'R0103:Itga1'
ID 34498
Institutional Source Beutler Lab
Gene Symbol Itga1
Ensembl Gene ENSMUSG00000042284
Gene Name integrin alpha 1
Synonyms E130012M19Rik, CD49A, Vla1
MMRRC Submission 038389-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.254) question?
Stock # R0103 (G1)
Quality Score 225
Status Validated (trace)
Chromosome 13
Chromosomal Location 115094615-115238500 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 115152790 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 211 (I211V)
Ref Sequence ENSEMBL: ENSMUSP00000077132 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061673]
AlphaFold Q3V3R4
Predicted Effect probably benign
Transcript: ENSMUST00000061673
AA Change: I211V

PolyPhen 2 Score 0.398 (Sensitivity: 0.89; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000077132
Gene: ENSMUSG00000042284
AA Change: I211V

DomainStartEndE-ValueType
Int_alpha 43 96 1.63e0 SMART
VWA 170 360 4.24e-44 SMART
Int_alpha 432 481 4.21e-3 SMART
Int_alpha 485 542 3.19e-12 SMART
Int_alpha 566 621 1.79e-15 SMART
Int_alpha 628 682 3.04e1 SMART
low complexity region 1108 1122 N/A INTRINSIC
PDB:2L8S|A 1135 1179 5e-10 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224119
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224268
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224865
Meta Mutation Damage Score 0.0789 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.8%
Validation Efficiency 99% (84/85)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the alpha 1 subunit of integrin receptors. This protein heterodimerizes with the beta 1 subunit to form a cell-surface receptor for collagen and laminin. The heterodimeric receptor is involved in cell-cell adhesion and may play a role in inflammation and fibrosis. The alpha 1 subunit contains an inserted (I) von Willebrand factor type I domain which is thought to be involved in collagen binding. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene are essentially normal although their kidneys are smaller and more succeptible to injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A C 11: 9,223,951 (GRCm39) R443S probably damaging Het
Anapc1 T C 2: 128,522,372 (GRCm39) probably benign Het
Aqr T A 2: 113,979,497 (GRCm39) I313F probably damaging Het
Arfgap3 A T 15: 83,206,922 (GRCm39) probably benign Het
Asah2 G T 19: 31,996,377 (GRCm39) H374N probably benign Het
Avl9 G T 6: 56,713,468 (GRCm39) R242L probably benign Het
Ccdc106 C A 7: 5,060,544 (GRCm39) Q35K probably benign Het
Ccm2l G T 2: 152,909,839 (GRCm39) E64* probably null Het
Cep85l A T 10: 53,154,270 (GRCm39) D776E possibly damaging Het
Cfap52 T A 11: 67,815,951 (GRCm39) I611F possibly damaging Het
Cldn22 C T 8: 48,277,589 (GRCm39) T9M probably benign Het
Coa7 T C 4: 108,195,338 (GRCm39) L89P possibly damaging Het
Cox7a2l A T 17: 83,821,701 (GRCm39) Y2N probably damaging Het
Ctns A C 11: 73,076,137 (GRCm39) I299M probably damaging Het
Cyp27a1 A C 1: 74,775,074 (GRCm39) E301A probably benign Het
Cyp2b13 A T 7: 25,788,135 (GRCm39) K421M probably damaging Het
Cyp4f40 G T 17: 32,895,282 (GRCm39) C468F probably damaging Het
Cyp4f40 C A 17: 32,895,283 (GRCm39) C468* probably null Het
Dcun1d5 G A 9: 7,188,788 (GRCm39) C74Y probably damaging Het
Dennd4c A G 4: 86,730,683 (GRCm39) Y860C probably benign Het
Dgkz T C 2: 91,764,550 (GRCm39) T1028A probably benign Het
Dhx58 T C 11: 100,586,096 (GRCm39) T642A probably damaging Het
Dlg4 A G 11: 69,922,019 (GRCm39) Y87C probably damaging Het
Dnah6 C T 6: 73,069,155 (GRCm39) E2511K probably damaging Het
Entpd5 C A 12: 84,443,717 (GRCm39) E9* probably null Het
Fbln2 A C 6: 91,248,532 (GRCm39) I1066L probably benign Het
Fhl2 C T 1: 43,192,381 (GRCm39) R4H probably benign Het
Frmpd1 T A 4: 45,229,884 (GRCm39) I17K probably damaging Het
Galnt2l A G 8: 122,996,472 (GRCm39) probably benign Het
Gbp7 T A 3: 142,252,299 (GRCm39) N627K probably benign Het
Gnptab A G 10: 88,265,381 (GRCm39) Y331C probably damaging Het
Hdac4 T C 1: 91,903,366 (GRCm39) E521G possibly damaging Het
Hibadh T A 6: 52,534,862 (GRCm39) M173L probably benign Het
Iba57 C T 11: 59,054,439 (GRCm39) A27T probably benign Het
Keg1 A T 19: 12,696,280 (GRCm39) I155F possibly damaging Het
Krt84 T C 15: 101,438,671 (GRCm39) E272G probably damaging Het
Lrp2 C A 2: 69,307,384 (GRCm39) V2892L probably benign Het
Ltb A G 17: 35,414,016 (GRCm39) probably benign Het
Masp1 G A 16: 23,276,768 (GRCm39) P579L probably damaging Het
Mtor T A 4: 148,618,359 (GRCm39) M1724K probably benign Het
Myo3a T G 2: 22,436,360 (GRCm39) probably benign Het
Myo9b C T 8: 71,776,493 (GRCm39) probably benign Het
Ncor1 G T 11: 62,233,871 (GRCm39) Q444K possibly damaging Het
Nek7 A T 1: 138,471,980 (GRCm39) C53* probably null Het
Obscn G T 11: 58,953,522 (GRCm39) Y4044* probably null Het
Or5b105 G A 19: 13,080,642 (GRCm39) R3C possibly damaging Het
Pcdh15 A T 10: 74,046,257 (GRCm39) D178V probably damaging Het
Pcsk6 T C 7: 65,578,845 (GRCm39) probably benign Het
Phxr4 T C 9: 13,343,087 (GRCm39) probably benign Het
Pkhd1 T A 1: 20,593,583 (GRCm39) D1510V probably benign Het
Pkhd1l1 T C 15: 44,460,537 (GRCm39) C4249R probably benign Het
Plxnb2 A G 15: 89,045,972 (GRCm39) Y968H possibly damaging Het
Prpf39 T C 12: 65,102,057 (GRCm39) V378A possibly damaging Het
Psd2 A G 18: 36,137,770 (GRCm39) N455S probably damaging Het
Ptch2 C A 4: 116,966,622 (GRCm39) probably benign Het
Rab4b A G 7: 26,873,927 (GRCm39) I117T probably benign Het
Rad9b A T 5: 122,469,590 (GRCm39) V348E probably damaging Het
Rcor1 T C 12: 111,076,212 (GRCm39) probably benign Het
Rhoc A T 3: 104,699,307 (GRCm39) E32V possibly damaging Het
Rnf40 T G 7: 127,199,743 (GRCm39) V925G probably damaging Het
Rptor G T 11: 119,775,793 (GRCm39) R988L probably benign Het
Slc25a32 A T 15: 38,963,292 (GRCm39) Y176* probably null Het
Slc7a1 T A 5: 148,289,236 (GRCm39) K4* probably null Het
Ss18 A C 18: 14,812,478 (GRCm39) Y38D probably damaging Het
Syt4 T A 18: 31,580,273 (GRCm39) probably benign Het
Taar4 A T 10: 23,837,304 (GRCm39) N305Y probably damaging Het
Taar7b A T 10: 23,876,192 (GRCm39) Y119F probably benign Het
Tcaf1 G T 6: 42,663,324 (GRCm39) D185E probably benign Het
Tmem138 T C 19: 10,552,316 (GRCm39) N62S possibly damaging Het
Tnfaip2 C T 12: 111,412,244 (GRCm39) T215M probably benign Het
Tnfrsf21 C T 17: 43,349,104 (GRCm39) H239Y probably benign Het
Tnfrsf25 C T 4: 152,201,405 (GRCm39) P65S possibly damaging Het
Trp53bp1 A T 2: 121,067,240 (GRCm39) S495R possibly damaging Het
Trpv3 T C 11: 73,184,805 (GRCm39) F597S probably damaging Het
Tsc22d4 A C 5: 137,745,378 (GRCm39) M1L possibly damaging Het
Ttc39a A G 4: 109,278,650 (GRCm39) probably null Het
Ttn T G 2: 76,591,570 (GRCm39) H21033P probably damaging Het
Ugt2a3 A G 5: 87,484,577 (GRCm39) V149A possibly damaging Het
Ush2a T G 1: 188,051,267 (GRCm39) I251R possibly damaging Het
Vamp4 T C 1: 162,417,108 (GRCm39) C114R possibly damaging Het
Wdr33 T C 18: 31,966,388 (GRCm39) V135A probably damaging Het
Zc3h13 T A 14: 75,567,908 (GRCm39) V1067E probably damaging Het
Zcwpw1 G A 5: 137,808,375 (GRCm39) W274* probably null Het
Zfp219 T A 14: 52,244,163 (GRCm39) H627L probably damaging Het
Other mutations in Itga1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00264:Itga1 APN 13 115,128,899 (GRCm39) missense possibly damaging 0.80
IGL00498:Itga1 APN 13 115,167,729 (GRCm39) missense probably benign 0.00
IGL00549:Itga1 APN 13 115,185,832 (GRCm39) missense possibly damaging 0.92
IGL00587:Itga1 APN 13 115,148,785 (GRCm39) missense probably damaging 1.00
IGL01021:Itga1 APN 13 115,133,536 (GRCm39) missense probably benign 0.29
IGL01289:Itga1 APN 13 115,122,762 (GRCm39) missense possibly damaging 0.79
IGL01636:Itga1 APN 13 115,143,484 (GRCm39) missense possibly damaging 0.73
IGL01791:Itga1 APN 13 115,124,197 (GRCm39) missense probably benign 0.00
IGL01796:Itga1 APN 13 115,121,657 (GRCm39) missense probably damaging 1.00
IGL02027:Itga1 APN 13 115,126,591 (GRCm39) splice site probably null
IGL02330:Itga1 APN 13 115,148,740 (GRCm39) missense probably damaging 1.00
IGL02480:Itga1 APN 13 115,124,184 (GRCm39) missense probably damaging 1.00
IGL02943:Itga1 APN 13 115,185,832 (GRCm39) missense possibly damaging 0.92
R0103:Itga1 UTSW 13 115,152,790 (GRCm39) missense probably benign 0.40
R0244:Itga1 UTSW 13 115,143,433 (GRCm39) splice site probably benign
R0265:Itga1 UTSW 13 115,128,995 (GRCm39) missense probably benign
R0302:Itga1 UTSW 13 115,148,854 (GRCm39) splice site probably benign
R0320:Itga1 UTSW 13 115,114,130 (GRCm39) splice site probably benign
R0389:Itga1 UTSW 13 115,128,996 (GRCm39) missense probably benign 0.04
R0443:Itga1 UTSW 13 115,128,996 (GRCm39) missense probably benign 0.04
R0574:Itga1 UTSW 13 115,103,097 (GRCm39) missense probably damaging 1.00
R0646:Itga1 UTSW 13 115,104,835 (GRCm39) missense probably benign
R0830:Itga1 UTSW 13 115,143,568 (GRCm39) missense probably benign 0.08
R2162:Itga1 UTSW 13 115,167,446 (GRCm39) missense probably benign 0.23
R2216:Itga1 UTSW 13 115,133,565 (GRCm39) missense probably benign 0.00
R2403:Itga1 UTSW 13 115,114,150 (GRCm39) missense probably benign 0.00
R3734:Itga1 UTSW 13 115,114,175 (GRCm39) missense probably benign
R4171:Itga1 UTSW 13 115,167,422 (GRCm39) nonsense probably null
R4402:Itga1 UTSW 13 115,138,102 (GRCm39) missense probably benign 0.00
R4675:Itga1 UTSW 13 115,138,227 (GRCm39) splice site probably null
R4684:Itga1 UTSW 13 115,185,906 (GRCm39) missense probably damaging 1.00
R4795:Itga1 UTSW 13 115,171,921 (GRCm39) missense probably damaging 1.00
R4796:Itga1 UTSW 13 115,171,921 (GRCm39) missense probably damaging 1.00
R4845:Itga1 UTSW 13 115,110,708 (GRCm39) nonsense probably null
R5147:Itga1 UTSW 13 115,121,678 (GRCm39) missense possibly damaging 0.91
R5155:Itga1 UTSW 13 115,171,839 (GRCm39) missense probably benign
R5234:Itga1 UTSW 13 115,185,839 (GRCm39) nonsense probably null
R5344:Itga1 UTSW 13 115,138,845 (GRCm39) missense possibly damaging 0.78
R5554:Itga1 UTSW 13 115,129,010 (GRCm39) nonsense probably null
R5662:Itga1 UTSW 13 115,122,707 (GRCm39) missense probably benign 0.03
R5945:Itga1 UTSW 13 115,103,126 (GRCm39) missense probably benign 0.02
R6150:Itga1 UTSW 13 115,104,769 (GRCm39) missense probably benign 0.01
R6241:Itga1 UTSW 13 115,096,673 (GRCm39) splice site probably null
R6276:Itga1 UTSW 13 115,117,388 (GRCm39) missense probably benign
R6369:Itga1 UTSW 13 115,102,196 (GRCm39) missense probably damaging 1.00
R6511:Itga1 UTSW 13 115,129,037 (GRCm39) missense probably damaging 0.98
R6663:Itga1 UTSW 13 115,110,641 (GRCm39) missense probably benign 0.02
R6783:Itga1 UTSW 13 115,133,513 (GRCm39) missense probably benign 0.22
R6931:Itga1 UTSW 13 115,138,099 (GRCm39) missense probably benign 0.39
R7069:Itga1 UTSW 13 115,104,776 (GRCm39) missense probably damaging 1.00
R7458:Itga1 UTSW 13 115,122,802 (GRCm39) missense probably benign 0.00
R7588:Itga1 UTSW 13 115,104,785 (GRCm39) missense possibly damaging 0.88
R7591:Itga1 UTSW 13 115,119,315 (GRCm39) missense probably damaging 1.00
R7597:Itga1 UTSW 13 115,110,676 (GRCm39) missense probably benign 0.28
R7615:Itga1 UTSW 13 115,133,458 (GRCm39) missense probably null 0.99
R7756:Itga1 UTSW 13 115,128,996 (GRCm39) missense probably benign 0.04
R7795:Itga1 UTSW 13 115,148,772 (GRCm39) missense probably damaging 1.00
R7819:Itga1 UTSW 13 115,185,837 (GRCm39) missense probably damaging 0.99
R8193:Itga1 UTSW 13 115,104,991 (GRCm39) critical splice donor site probably null
R8313:Itga1 UTSW 13 115,103,120 (GRCm39) missense probably benign 0.06
R8419:Itga1 UTSW 13 115,143,604 (GRCm39) missense probably damaging 1.00
R8925:Itga1 UTSW 13 115,105,055 (GRCm39) missense probably benign 0.01
R8927:Itga1 UTSW 13 115,105,055 (GRCm39) missense probably benign 0.01
R8951:Itga1 UTSW 13 115,107,027 (GRCm39) nonsense probably null
R9099:Itga1 UTSW 13 115,185,856 (GRCm39) missense probably damaging 1.00
R9200:Itga1 UTSW 13 115,104,997 (GRCm39) missense possibly damaging 0.80
R9221:Itga1 UTSW 13 115,166,695 (GRCm39) nonsense probably null
R9249:Itga1 UTSW 13 115,185,834 (GRCm39) missense probably damaging 1.00
R9267:Itga1 UTSW 13 115,185,924 (GRCm39) missense possibly damaging 0.50
R9376:Itga1 UTSW 13 115,107,112 (GRCm39) missense probably benign 0.07
R9481:Itga1 UTSW 13 115,152,753 (GRCm39) missense probably benign 0.34
R9789:Itga1 UTSW 13 115,171,820 (GRCm39) nonsense probably null
Z1177:Itga1 UTSW 13 115,121,607 (GRCm39) critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GCCTTCCCTGTATGTCAGCATCC -3'
(R):5'- GGACTGTTTATATTCGCAGAGTGGCT -3'

Sequencing Primer
(F):5'- gcagaagaggagacagaaagg -3'
(R):5'- CACGGAGCCTGAAAAGCTAA -3'
Posted On 2013-05-09