Incidental Mutation 'R4614:Muc4'
ID344981
Institutional Source Beutler Lab
Gene Symbol Muc4
Ensembl Gene ENSMUSG00000079620
Gene Namemucin 4
Synonyms4933405I11Rik
MMRRC Submission 041825-MU
Accession Numbers

Genbank: NM_080457; MGI: 2153525

Is this an essential gene? Probably non essential (E-score: 0.081) question?
Stock #R4614 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location32735886-32782391 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 32757058 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 241 (K241E)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096106]
Predicted Effect unknown
Transcript: ENSMUST00000096106
AA Change: K2311E
SMART Domains Protein: ENSMUSP00000093813
Gene: ENSMUSG00000079620
AA Change: K2311E

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
low complexity region 37 65 N/A INTRINSIC
low complexity region 86 111 N/A INTRINSIC
internal_repeat_2 119 903 6.07e-127 PROSPERO
internal_repeat_1 164 987 3.47e-144 PROSPERO
internal_repeat_2 979 1875 6.07e-127 PROSPERO
internal_repeat_1 1193 2087 3.47e-144 PROSPERO
low complexity region 2090 2106 N/A INTRINSIC
low complexity region 2111 2119 N/A INTRINSIC
low complexity region 2186 2195 N/A INTRINSIC
low complexity region 2230 2249 N/A INTRINSIC
low complexity region 2324 2332 N/A INTRINSIC
low complexity region 2344 2367 N/A INTRINSIC
NIDO 2458 2615 8.33e-67 SMART
AMOP 2614 2726 1.29e-47 SMART
VWD 2729 2910 4.23e-26 SMART
EGF_like 3134 3166 3.23e1 SMART
EGF_like 3176 3212 3.5e1 SMART
low complexity region 3237 3251 N/A INTRINSIC
EGF 3384 3421 1.4e0 SMART
transmembrane domain 3430 3452 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000135753
AA Change: K241E

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000119154
Gene: ENSMUSG00000079620
AA Change: K241E

DomainStartEndE-ValueType
low complexity region 21 37 N/A INTRINSIC
low complexity region 42 50 N/A INTRINSIC
low complexity region 117 126 N/A INTRINSIC
low complexity region 161 180 N/A INTRINSIC
low complexity region 255 263 N/A INTRINSIC
low complexity region 275 298 N/A INTRINSIC
NIDO 389 546 8.33e-67 SMART
AMOP 545 657 1.29e-47 SMART
VWD 660 841 4.23e-26 SMART
EGF_like 1065 1097 3.23e1 SMART
EGF_like 1107 1143 3.5e1 SMART
low complexity region 1168 1182 N/A INTRINSIC
EGF 1315 1352 1.4e0 SMART
transmembrane domain 1361 1383 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142355
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 98% (95/97)
MGI Phenotype FUNCTION: The major constituents of mucus, the viscous secretion that covers epithelial surfaces such as those in the trachea, colon, and cervix, are highly glycosylated proteins called mucins. These glycoproteins play important roles in the protection of the epithelial cells and have been implicated in epithelial renewal and differentiation. This gene encodes an integral membrane glycoprotein found on the cell surface. A large 5' exon encodes at least 15 tandem repeats of 124-126 amino acids. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit resistance to DSS-treated colitis and colitis-associated colorectal cancer. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik T G 13: 77,254,256 probably null Het
4932414N04Rik C A 2: 68,745,460 T701K probably benign Het
6030419C18Rik AGAGGAGGAGGAGGAGG AGAGGAGGAGGAGG 9: 58,499,432 probably benign Het
Abcb11 A T 2: 69,284,681 H640Q possibly damaging Het
Ago2 C T 15: 73,130,967 V139M probably damaging Het
Apol11a A T 15: 77,516,572 K86N probably benign Het
Ass1 T C 2: 31,514,783 Y359H probably damaging Het
Bpifa3 A T 2: 154,136,280 N34I probably damaging Het
Brwd1 A T 16: 96,047,359 L540H probably damaging Het
C3ar1 G A 6: 122,850,721 S179F probably benign Het
Ccnb1ip1 T C 14: 50,792,195 T137A probably benign Het
Cd5l A G 3: 87,368,619 T299A probably benign Het
Cdk12 T A 11: 98,249,777 probably benign Het
Cep290 T C 10: 100,508,740 M480T probably benign Het
Cep290 G A 10: 100,559,687 R2112K possibly damaging Het
Chn2 G A 6: 54,290,403 M292I probably damaging Het
Cic TCCCCC TCCCCCCC 7: 25,291,670 probably null Het
Cpeb1 A T 7: 81,436,270 D41E possibly damaging Het
Csf2rb2 C G 15: 78,291,702 C184S probably damaging Het
Ctsc G A 7: 88,278,375 probably null Het
Cyp2c40 G A 19: 39,803,856 S191L probably damaging Het
Dagla T C 19: 10,248,277 E841G probably damaging Het
Dld A T 12: 31,333,945 Y386* probably null Het
Dpp8 G A 9: 65,066,396 S634N probably benign Het
Duox2 A T 2: 122,289,557 V824E probably damaging Het
Dync2h1 A C 9: 7,011,290 S3634R probably benign Het
Eef1d T C 15: 75,903,576 N78S probably benign Het
Fcrl5 T A 3: 87,448,426 I482N probably damaging Het
Fezf1 A T 6: 23,247,858 C73S possibly damaging Het
Fgfr1 A G 8: 25,557,797 D53G probably benign Het
Fmn1 T C 2: 113,365,149 L398S unknown Het
Gm17175 T C 14: 51,571,585 Q108R probably benign Het
Gm28042 G A 2: 120,041,158 G669D probably damaging Het
Gm6185 A G 1: 161,223,099 noncoding transcript Het
Gucy2g A T 19: 55,202,147 C1018* probably null Het
H2-Q10 A T 17: 35,474,020 probably benign Het
H2-T22 T G 17: 36,040,537 Q267P probably benign Het
Hibadh A G 6: 52,546,930 Y328H possibly damaging Het
Hsd3b3 T A 3: 98,742,080 Y309F probably benign Het
Ighv1-37 C T 12: 114,896,243 A116T probably benign Het
Ighv1-82 T C 12: 115,952,660 T77A probably benign Het
Igkv8-21 A T 6: 70,315,157 S34T probably benign Het
Iqch A G 9: 63,482,581 M733T probably benign Het
Jakmip2 T A 18: 43,562,592 D539V probably damaging Het
Lgi2 A G 5: 52,538,433 S395P probably damaging Het
Lrrc40 A T 3: 158,054,634 N344I probably damaging Het
Ltbp1 G A 17: 75,289,994 probably benign Het
Metap1d C T 2: 71,524,948 P332L probably benign Het
Mfap4 C A 11: 61,485,509 probably benign Het
Mis18bp1 T A 12: 65,153,529 probably benign Het
Mta2 T C 19: 8,948,128 probably null Het
Mtmr4 T C 11: 87,610,935 L548S probably damaging Het
Mup18 T A 4: 61,671,917 I125F possibly damaging Het
Nfs1 A G 2: 156,144,050 S31P probably benign Het
Olfr38 G T 6: 42,762,418 R122L probably benign Het
Olfr419 A G 1: 174,250,622 F102L possibly damaging Het
Olfr981 T A 9: 40,022,959 C189S probably damaging Het
Otogl A T 10: 107,892,124 C245* probably null Het
Pcdhb16 G A 18: 37,480,345 G786D probably benign Het
Pdcd5 C T 7: 35,647,047 probably benign Het
Phkg2 C T 7: 127,577,620 R61W probably damaging Het
Piezo1 A T 8: 122,486,411 I1871N probably benign Het
Pkd2l1 C A 19: 44,154,134 A490S probably damaging Het
Plxnd1 T C 6: 115,972,525 T767A possibly damaging Het
Polr3c T G 3: 96,716,471 I322L probably benign Het
Ppp1r26 C A 2: 28,450,848 H163Q probably benign Het
Prox1 T G 1: 190,162,008 Y80S probably damaging Het
Pygl T C 12: 70,210,979 probably null Het
Rab23 T C 1: 33,739,385 V236A probably benign Het
Setd2 T C 9: 110,569,813 probably null Het
Slc5a7 A G 17: 54,276,559 S568P probably benign Het
Smpd3 A G 8: 106,259,739 L477P probably damaging Het
Spg21 A G 9: 65,480,389 probably null Het
Spta1 A T 1: 174,192,977 I551F probably damaging Het
Supt5 A T 7: 28,325,972 I135N possibly damaging Het
Tacstd2 A G 6: 67,535,186 F174S probably damaging Het
Tas1r2 A T 4: 139,659,787 T186S probably damaging Het
Tie1 A G 4: 118,479,051 Y673H probably damaging Het
Tom1l1 A T 11: 90,671,126 N190K probably damaging Het
Tox2 T C 2: 163,320,647 L479P probably damaging Het
Tox4 C T 14: 52,287,467 T249I probably damaging Het
Trmt1l C T 1: 151,454,048 Q581* probably null Het
Vmn1r49 A G 6: 90,072,552 V156A probably benign Het
Vmn2r13 A T 5: 109,175,199 F75I probably benign Het
Washc2 T A 6: 116,238,174 S502T possibly damaging Het
Wnk4 A T 11: 101,274,111 E755D probably benign Het
Zfp207 T A 11: 80,395,190 probably benign Het
Zfp352 A G 4: 90,225,081 K486R probably benign Het
Other mutations in Muc4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Muc4 APN 16 32754086 missense probably benign 0.35
IGL00088:Muc4 APN 16 32754086 missense probably benign 0.35
IGL00089:Muc4 APN 16 32754086 missense probably benign 0.35
IGL00090:Muc4 APN 16 32754086 missense probably benign 0.35
IGL00091:Muc4 APN 16 32754086 missense probably benign 0.35
IGL00092:Muc4 APN 16 32754086 missense probably benign 0.35
IGL00163:Muc4 APN 16 32754090 missense probably benign 0.20
IGL00324:Muc4 APN 16 32778812 missense probably benign 0.03
IGL00331:Muc4 APN 16 32753185 missense probably benign 0.01
IGL00539:Muc4 APN 16 32750910 missense possibly damaging 0.53
IGL00590:Muc4 APN 16 32754347 missense probably benign 0.10
IGL00990:Muc4 APN 16 32753955 missense possibly damaging 0.86
IGL00990:Muc4 APN 16 32755805 unclassified probably benign
IGL00990:Muc4 APN 16 32753823 missense probably benign 0.01
IGL00990:Muc4 APN 16 32753848 missense probably benign 0.01
IGL00990:Muc4 APN 16 32753849 missense probably benign 0.01
IGL00990:Muc4 APN 16 32753863 missense probably benign 0.01
IGL00990:Muc4 APN 16 32753886 missense probably benign 0.01
IGL00990:Muc4 APN 16 32752569 missense probably benign 0.01
IGL00990:Muc4 APN 16 32754071 missense probably benign 0.01
IGL01091:Muc4 APN 16 32753927 missense probably benign 0.04
IGL01124:Muc4 APN 16 32768730 missense possibly damaging 0.65
IGL01131:Muc4 APN 16 32753901 missense possibly damaging 0.72
IGL01536:Muc4 APN 16 32763966 missense possibly damaging 0.93
IGL01603:Muc4 APN 16 32750655 missense probably benign 0.23
IGL01618:Muc4 APN 16 32756627 missense unknown
IGL01625:Muc4 APN 16 32755544 unclassified probably benign
IGL01626:Muc4 APN 16 32736402 missense possibly damaging 0.48
IGL01653:Muc4 APN 16 32761348 splice site probably null
IGL01682:Muc4 APN 16 32754086 missense probably benign 0.35
IGL01870:Muc4 APN 16 32753196 missense probably benign 0.01
IGL01966:Muc4 APN 16 32751426 missense possibly damaging 0.84
IGL01973:Muc4 APN 16 32754265 missense probably benign 0.01
IGL02089:Muc4 APN 16 32751313 missense possibly damaging 0.83
IGL02152:Muc4 APN 16 32777649 splice site probably benign
IGL02210:Muc4 APN 16 32752254 missense probably benign 0.00
IGL02278:Muc4 APN 16 32754529 missense probably benign 0.01
IGL02280:Muc4 APN 16 32754529 missense probably benign 0.01
IGL02316:Muc4 APN 16 32750850 missense possibly damaging 0.73
IGL02351:Muc4 APN 16 32750986 missense possibly damaging 0.86
IGL02358:Muc4 APN 16 32750986 missense possibly damaging 0.86
IGL02391:Muc4 APN 16 32752076 missense probably benign 0.41
IGL02449:Muc4 APN 16 32756129 unclassified probably benign
IGL02607:Muc4 APN 16 32775819 missense possibly damaging 0.73
IGL02888:Muc4 APN 16 32755282 unclassified probably benign
IGL02893:Muc4 APN 16 32751648 missense possibly damaging 0.68
IGL02902:Muc4 APN 16 32750394 missense possibly damaging 0.50
IGL03007:Muc4 APN 16 32752048 missense possibly damaging 0.84
IGL03161:Muc4 APN 16 32751948 missense possibly damaging 0.84
IGL03304:Muc4 APN 16 32751439 nonsense probably null
IGL03335:Muc4 APN 16 32753021 missense probably benign 0.01
IGL03411:Muc4 APN 16 32754318 missense probably benign 0.01
3-1:Muc4 UTSW 16 32760251 splice site probably benign
3-1:Muc4 UTSW 16 32770394 missense possibly damaging 0.86
IGL02835:Muc4 UTSW 16 32763945 missense probably benign 0.32
P0035:Muc4 UTSW 16 32760248 splice site probably benign
PIT4131001:Muc4 UTSW 16 32755676 unclassified probably benign
PIT4131001:Muc4 UTSW 16 32755684 unclassified probably benign
PIT4131001:Muc4 UTSW 16 32755699 unclassified probably benign
PIT4142001:Muc4 UTSW 16 32754529 missense probably benign 0.01
PIT4142001:Muc4 UTSW 16 32755676 unclassified probably benign
PIT4142001:Muc4 UTSW 16 32755684 unclassified probably benign
PIT4366001:Muc4 UTSW 16 32754796 missense unknown
PIT4531001:Muc4 UTSW 16 32756017 missense unknown
R0119:Muc4 UTSW 16 32750195 critical splice acceptor site probably benign
R0133:Muc4 UTSW 16 32771604 missense possibly damaging 0.91
R0136:Muc4 UTSW 16 32750195 critical splice acceptor site probably benign
R0243:Muc4 UTSW 16 32765746 missense possibly damaging 0.53
R0277:Muc4 UTSW 16 32755690 unclassified probably benign
R0299:Muc4 UTSW 16 32750195 critical splice acceptor site probably benign
R0380:Muc4 UTSW 16 32752905 missense probably benign 0.00
R0462:Muc4 UTSW 16 32762536 missense possibly damaging 0.93
R0507:Muc4 UTSW 16 32751069 missense probably benign 0.01
R0508:Muc4 UTSW 16 32751313 missense possibly damaging 0.83
R0543:Muc4 UTSW 16 32756746 missense unknown
R0578:Muc4 UTSW 16 32755690 unclassified probably benign
R0617:Muc4 UTSW 16 32752107 missense possibly damaging 0.83
R0656:Muc4 UTSW 16 32751670 missense possibly damaging 0.91
R0726:Muc4 UTSW 16 32769827 missense probably damaging 0.99
R0727:Muc4 UTSW 16 32769847 missense probably benign 0.01
R0776:Muc4 UTSW 16 32752220 missense probably benign 0.04
R0854:Muc4 UTSW 16 32778955 missense possibly damaging 0.53
R0862:Muc4 UTSW 16 32752002 missense probably benign 0.01
R0864:Muc4 UTSW 16 32752002 missense probably benign 0.01
R0926:Muc4 UTSW 16 32756196 unclassified probably benign
R0990:Muc4 UTSW 16 32752722 missense probably benign 0.00
R1127:Muc4 UTSW 16 32750525 missense possibly damaging 0.92
R1203:Muc4 UTSW 16 32754529 missense probably benign 0.01
R1433:Muc4 UTSW 16 32753020 missense probably benign 0.00
R1466:Muc4 UTSW 16 32753595 missense probably benign 0.04
R1466:Muc4 UTSW 16 32753595 missense probably benign 0.04
R1506:Muc4 UTSW 16 32752233 missense possibly damaging 0.59
R1518:Muc4 UTSW 16 32750349 missense possibly damaging 0.84
R1544:Muc4 UTSW 16 32753919 missense probably benign 0.10
R1584:Muc4 UTSW 16 32753595 missense probably benign 0.04
R1593:Muc4 UTSW 16 32754686 missense probably benign 0.00
R1601:Muc4 UTSW 16 32755501 unclassified probably benign
R1611:Muc4 UTSW 16 32750986 missense possibly damaging 0.86
R1673:Muc4 UTSW 16 32756902 missense probably benign 0.11
R1717:Muc4 UTSW 16 32753405 missense possibly damaging 0.53
R1822:Muc4 UTSW 16 32753919 missense probably benign 0.10
R1824:Muc4 UTSW 16 32755933 unclassified probably benign
R1839:Muc4 UTSW 16 32753919 missense probably benign 0.10
R1846:Muc4 UTSW 16 32752369 missense probably benign 0.01
R1864:Muc4 UTSW 16 32756251 unclassified probably benign
R1868:Muc4 UTSW 16 32756341 missense unknown
R1928:Muc4 UTSW 16 32750532 missense probably damaging 0.99
R1942:Muc4 UTSW 16 32750642 missense probably damaging 0.99
R2017:Muc4 UTSW 16 32751303 missense possibly damaging 0.92
R2023:Muc4 UTSW 16 32752254 missense probably benign 0.00
R2081:Muc4 UTSW 16 32752220 missense probably benign 0.04
R2088:Muc4 UTSW 16 32756409 missense unknown
R2121:Muc4 UTSW 16 32760238 missense unknown
R2139:Muc4 UTSW 16 32761225 missense unknown
R2158:Muc4 UTSW 16 32754563 missense probably benign 0.10
R2165:Muc4 UTSW 16 32750476 missense probably damaging 0.96
R2210:Muc4 UTSW 16 32755176 frame shift probably null
R2225:Muc4 UTSW 16 32755891 unclassified probably benign
R2225:Muc4 UTSW 16 32766942 missense possibly damaging 0.73
R2269:Muc4 UTSW 16 32754529 missense probably benign 0.01
R2679:Muc4 UTSW 16 32757472 missense unknown
R3703:Muc4 UTSW 16 32753919 missense probably benign 0.10
R3816:Muc4 UTSW 16 32754529 missense probably benign 0.01
R3909:Muc4 UTSW 16 32753919 missense probably benign 0.10
R4014:Muc4 UTSW 16 32755273 unclassified probably benign
R4065:Muc4 UTSW 16 32751051 missense possibly damaging 0.53
R4066:Muc4 UTSW 16 32751051 missense possibly damaging 0.53
R4067:Muc4 UTSW 16 32751051 missense possibly damaging 0.53
R4245:Muc4 UTSW 16 32753802 missense probably benign 0.04
R4249:Muc4 UTSW 16 32755826 unclassified probably benign
R4344:Muc4 UTSW 16 32770292 missense possibly damaging 0.53
R4388:Muc4 UTSW 16 32753802 missense probably benign 0.04
R4393:Muc4 UTSW 16 32754529 missense probably benign 0.01
R4482:Muc4 UTSW 16 32756701 missense unknown
R4523:Muc4 UTSW 16 32736336 utr 5 prime probably benign
R4527:Muc4 UTSW 16 32755843 unclassified probably benign
R4572:Muc4 UTSW 16 32753802 missense probably benign 0.04
R4587:Muc4 UTSW 16 32753919 missense probably benign 0.10
R4635:Muc4 UTSW 16 32753802 missense probably benign 0.04
R4661:Muc4 UTSW 16 32769277 missense possibly damaging 0.71
R4701:Muc4 UTSW 16 32755846 unclassified probably benign
R4730:Muc4 UTSW 16 32751214 missense possibly damaging 0.86
R4740:Muc4 UTSW 16 32775903 missense possibly damaging 0.91
R4762:Muc4 UTSW 16 32753625 unclassified probably benign
R4818:Muc4 UTSW 16 32753919 missense probably benign 0.10
R4821:Muc4 UTSW 16 32753802 missense probably benign 0.04
R4825:Muc4 UTSW 16 32751747 missense probably benign 0.41
R4830:Muc4 UTSW 16 32753919 missense probably benign 0.10
R4860:Muc4 UTSW 16 32754616 missense probably benign 0.35
R4860:Muc4 UTSW 16 32754625 missense probably benign 0.18
R4869:Muc4 UTSW 16 32754836 unclassified probably benign
R4934:Muc4 UTSW 16 32756098 unclassified probably benign
R4959:Muc4 UTSW 16 32754319 missense possibly damaging 0.73
R4969:Muc4 UTSW 16 32754572 missense probably benign 0.01
R4995:Muc4 UTSW 16 32754214 missense probably benign 0.01
R4995:Muc4 UTSW 16 32754041 missense probably benign 0.01
R4999:Muc4 UTSW 16 32756296 unclassified probably benign
R5073:Muc4 UTSW 16 32754529 missense probably benign 0.01
R5075:Muc4 UTSW 16 32754794 unclassified probably benign
R5152:Muc4 UTSW 16 32757058 nonsense probably null
R5161:Muc4 UTSW 16 32762521 missense probably damaging 0.98
R5174:Muc4 UTSW 16 32751738 missense possibly damaging 0.84
R5268:Muc4 UTSW 16 32751666 missense possibly damaging 0.83
R5447:Muc4 UTSW 16 32753919 missense probably benign 0.10
R5474:Muc4 UTSW 16 32761261 missense unknown
R5567:Muc4 UTSW 16 32777692 missense possibly damaging 0.72
R5570:Muc4 UTSW 16 32777692 missense possibly damaging 0.72
R5618:Muc4 UTSW 16 32754253 missense probably benign 0.01
R5665:Muc4 UTSW 16 32750782 missense probably benign 0.33
R5667:Muc4 UTSW 16 32753720 missense probably benign 0.01
R5671:Muc4 UTSW 16 32753720 missense probably benign 0.01
R5693:Muc4 UTSW 16 32776807 missense possibly damaging 0.53
R5703:Muc4 UTSW 16 32736241 nonsense probably null
R5708:Muc4 UTSW 16 32754769 unclassified probably benign
R5715:Muc4 UTSW 16 32751916 missense possibly damaging 0.92
R5849:Muc4 UTSW 16 32774839 missense possibly damaging 0.53
R5873:Muc4 UTSW 16 32751295 missense possibly damaging 0.61
R5930:Muc4 UTSW 16 32751705 missense probably benign 0.41
R5933:Muc4 UTSW 16 32753052 missense probably benign 0.01
R5966:Muc4 UTSW 16 32756278 unclassified probably benign
R6062:Muc4 UTSW 16 32759308 missense unknown
R6067:Muc4 UTSW 16 32755247 unclassified probably benign
R6067:Muc4 UTSW 16 32754529 missense probably benign 0.01
R6078:Muc4 UTSW 16 32755247 unclassified probably benign
R6079:Muc4 UTSW 16 32755247 unclassified probably benign
R6112:Muc4 UTSW 16 32775783 missense possibly damaging 0.86
R6120:Muc4 UTSW 16 32756795 missense unknown
R6144:Muc4 UTSW 16 32766924 missense possibly damaging 0.53
R6148:Muc4 UTSW 16 32753802 missense probably benign 0.04
R6173:Muc4 UTSW 16 32736140 start gained probably benign
R6268:Muc4 UTSW 16 32768767 missense probably damaging 0.99
R6299:Muc4 UTSW 16 32752035 missense possibly damaging 0.48
R6307:Muc4 UTSW 16 32753946 missense possibly damaging 0.56
R6354:Muc4 UTSW 16 32754358 missense probably benign 0.19
R6361:Muc4 UTSW 16 32767351 missense probably benign 0.32
R6375:Muc4 UTSW 16 32736243 utr 5 prime probably benign
R6378:Muc4 UTSW 16 32778946 missense probably benign 0.33
R6418:Muc4 UTSW 16 32751789 missense possibly damaging 0.68
R6458:Muc4 UTSW 16 32759320 critical splice donor site probably null
R6527:Muc4 UTSW 16 32753433 missense probably benign 0.01
R6616:Muc4 UTSW 16 32782008 missense possibly damaging 0.93
R6636:Muc4 UTSW 16 32753964 missense probably benign 0.01
R6637:Muc4 UTSW 16 32753964 missense probably benign 0.01
R6915:Muc4 UTSW 16 32766938 missense probably benign 0.18
R6947:Muc4 UTSW 16 32775803 missense possibly damaging 0.91
R6976:Muc4 UTSW 16 32762518 missense possibly damaging 0.92
R6985:Muc4 UTSW 16 32751999 missense probably benign 0.00
R7020:Muc4 UTSW 16 32751810 nonsense probably null
R7033:Muc4 UTSW 16 32756324 unclassified probably benign
R7098:Muc4 UTSW 16 32757091 missense
R7123:Muc4 UTSW 16 32750691 missense possibly damaging 0.83
R7173:Muc4 UTSW 16 32762488 missense probably damaging 0.97
R7178:Muc4 UTSW 16 32752788 missense unknown
R7294:Muc4 UTSW 16 32756461 missense possibly damaging 0.53
R7318:Muc4 UTSW 16 32755336 missense unknown
R7361:Muc4 UTSW 16 32754670 missense probably benign 0.18
R7380:Muc4 UTSW 16 32755366 missense unknown
R7381:Muc4 UTSW 16 32780915 missense
R7411:Muc4 UTSW 16 32751322 missense probably benign 0.12
R7422:Muc4 UTSW 16 32754689 missense probably benign 0.00
R7482:Muc4 UTSW 16 32766950 missense
R7539:Muc4 UTSW 16 32756396 missense
R7544:Muc4 UTSW 16 32736198 start codon destroyed probably null
R7574:Muc4 UTSW 16 32753411 missense probably benign 0.18
R7576:Muc4 UTSW 16 32754500 missense probably benign 0.10
R7585:Muc4 UTSW 16 32765702 missense
R7594:Muc4 UTSW 16 32753930 missense probably benign 0.01
R7595:Muc4 UTSW 16 32753930 missense probably benign 0.01
R7596:Muc4 UTSW 16 32753930 missense probably benign 0.01
R7597:Muc4 UTSW 16 32753930 missense probably benign 0.01
R7601:Muc4 UTSW 16 32753930 missense probably benign 0.01
R7602:Muc4 UTSW 16 32753930 missense probably benign 0.01
R7616:Muc4 UTSW 16 32752361 nonsense probably null
R7639:Muc4 UTSW 16 32753930 missense probably benign 0.01
R7640:Muc4 UTSW 16 32760105 missense
R7651:Muc4 UTSW 16 32756575 missense
R7688:Muc4 UTSW 16 32751460 missense possibly damaging 0.68
R7689:Muc4 UTSW 16 32753011 missense probably benign 0.10
U15987:Muc4 UTSW 16 32754529 missense probably benign 0.01
U15987:Muc4 UTSW 16 32755247 unclassified probably benign
V5622:Muc4 UTSW 16 32751825 missense probably benign 0.00
X0018:Muc4 UTSW 16 32755481 unclassified probably benign
X0028:Muc4 UTSW 16 32759319 critical splice donor site probably null
Z1088:Muc4 UTSW 16 32756076 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- GCATCCTCACCAGCACATTG -3'
(R):5'- GGGCCTTCATGCATAAGAAAAG -3'

Sequencing Primer
(F):5'- TAACTAGAAGCCTCGGTGTGATCAC -3'
(R):5'- CTTCATGCATAAGAAAAGGCGGC -3'
Posted On2015-09-25