Incidental Mutation 'R4615:Cubn'
ID344998
Institutional Source Beutler Lab
Gene Symbol Cubn
Ensembl Gene ENSMUSG00000026726
Gene Namecubilin (intrinsic factor-cobalamin receptor)
SynonymsD2Wsu88e
MMRRC Submission 041826-MU
Accession Numbers

Genbank: NM_001081084; MGI: 1931256

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4615 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location13276338-13491813 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 13428749 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 1117 (S1117P)
Ref Sequence ENSEMBL: ENSMUSP00000089009 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091436]
Predicted Effect probably damaging
Transcript: ENSMUST00000091436
AA Change: S1117P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000089009
Gene: ENSMUSG00000026726
AA Change: S1117P

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
EGF 132 165 2.14e-5 SMART
EGF_CA 167 208 1.95e-8 SMART
EGF 213 258 2.85e-1 SMART
EGF_CA 260 301 2.66e-10 SMART
EGF_CA 302 345 7.07e-6 SMART
EGF 349 393 1.01e-1 SMART
EGF 398 430 3.73e-5 SMART
EGF_CA 432 468 8.63e-10 SMART
CUB 474 586 4.4e-21 SMART
CUB 590 702 3.82e-39 SMART
CUB 708 816 3.66e-18 SMART
CUB 817 928 3.09e-25 SMART
CUB 932 1042 1.29e-36 SMART
CUB 1048 1161 3.46e-37 SMART
CUB 1165 1277 7.24e-40 SMART
CUB 1278 1389 8.33e-31 SMART
CUB 1391 1506 3.08e-43 SMART
CUB 1510 1619 1.9e-34 SMART
CUB 1620 1734 7.24e-40 SMART
CUB 1738 1850 6.02e-37 SMART
CUB 1852 1963 1.57e-26 SMART
CUB 1978 2091 3.46e-28 SMART
CUB 2092 2213 2.88e-34 SMART
CUB 2217 2334 4.13e-35 SMART
CUB 2336 2448 3.1e-39 SMART
CUB 2452 2565 5.37e-34 SMART
CUB 2570 2687 3e-23 SMART
CUB 2689 2801 3.1e-39 SMART
CUB 2805 2919 2.36e-21 SMART
CUB 2920 3035 6.18e-25 SMART
CUB 3037 3150 5.16e-36 SMART
CUB 3157 3274 1.68e-35 SMART
CUB 3278 3393 7.17e-12 SMART
CUB 3395 3507 2.49e-29 SMART
CUB 3511 3623 2.4e-22 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195447
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Cubilin (CUBN) acts as a receptor for intrinsic factor-vitamin B12 complexes. The role of receptor is supported by the presence of 27 CUB domains. Cubulin is located within the epithelium of intestine and kidney. Mutations in CUBN may play a role in autosomal recessive megaloblastic anemia. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation display embryonic lethality during organogenesis, yolk sac and allantoic vasculature defects, embryonic and visceral endoderm defects, and lack somites. Heterozygotes display incomplete penetrance of premature death. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted, other(1) Gene trapped(3)

Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 T C 1: 71,330,334 I363V probably benign Het
Abcc9 C G 6: 142,689,107 A144P possibly damaging Het
Adgrv1 C T 13: 81,494,569 probably null Het
Adprhl1 A G 8: 13,242,250 probably null Het
Angptl3 A T 4: 99,031,361 E119D probably benign Het
Atp8b1 T C 18: 64,553,099 N671S probably null Het
C9 A G 15: 6,491,463 D51G probably damaging Het
Carmil2 A G 8: 105,695,074 D1019G possibly damaging Het
Cdh8 A T 8: 99,279,622 I111K probably damaging Het
Cep120 T C 18: 53,714,841 R649G probably damaging Het
Clptm1l A T 13: 73,607,738 K158* probably null Het
Cmtm1 CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT 8: 104,309,470 probably benign Het
Cnga1 A C 5: 72,604,774 L466V probably damaging Het
Cpsf1 T C 15: 76,596,937 T1240A possibly damaging Het
Cyp2b9 T A 7: 26,201,125 L396Q probably damaging Het
Cyp8b1 A T 9: 121,916,098 L56* probably null Het
Dcbld2 A G 16: 58,456,094 T458A probably benign Het
Dio2 G T 12: 90,729,821 P131Q probably damaging Het
Dlg5 T C 14: 24,158,168 Y990C probably damaging Het
Dsc3 T C 18: 19,971,488 D594G possibly damaging Het
Dsp A G 13: 38,191,632 E1131G probably damaging Het
Fdx1 A T 9: 51,948,645 Y21* probably null Het
Gal3st4 A G 5: 138,266,263 V158A probably damaging Het
Gm10269 T A 18: 20,682,763 E67D probably benign Het
Gm5773 A G 3: 93,774,032 H337R probably benign Het
Gm7102 C T 19: 61,175,926 G24R unknown Het
Gng2 C T 14: 19,891,327 V16I possibly damaging Het
Gpr20 T C 15: 73,695,736 N268S probably benign Het
Ighv1-82 T C 12: 115,952,660 T77A probably benign Het
Lama2 C A 10: 26,981,524 V3110F probably damaging Het
Mtmr4 T C 11: 87,610,935 L548S probably damaging Het
Ncapg A T 5: 45,687,399 M579L probably benign Het
Olfr1338 T C 4: 118,754,137 T134A probably benign Het
Olfr292 T C 7: 86,694,728 S91P probably damaging Het
Oog3 A T 4: 144,158,329 Y346N probably benign Het
Orm2 A G 4: 63,363,299 D89G probably damaging Het
Pcdhb4 T A 18: 37,308,500 S288T probably benign Het
Pcsk2 G T 2: 143,795,969 C375F probably damaging Het
Pdcd10 T C 3: 75,521,091 I138M probably damaging Het
Pde8a T C 7: 81,320,737 W536R probably damaging Het
Phkg2 C T 7: 127,577,620 R61W probably damaging Het
Plcl1 A T 1: 55,698,134 N878I probably benign Het
Prkdc A T 16: 15,663,074 D353V probably damaging Het
Psme4 C T 11: 30,834,287 T954I probably benign Het
Ran A G 5: 129,022,098 I115V probably benign Het
Reln A G 5: 21,972,872 L1867P possibly damaging Het
S100a1 A G 3: 90,511,255 V84A possibly damaging Het
Sall2 G A 14: 52,312,750 P994L probably benign Het
Shtn1 A T 19: 59,022,216 I273N probably benign Het
Slc17a9 T C 2: 180,731,906 I40T probably benign Het
Slc29a2 T C 19: 5,029,264 V305A probably damaging Het
Ssfa2 A G 2: 79,662,382 E1091G probably damaging Het
Taar2 T A 10: 23,941,365 F268I probably benign Het
Taf3 G A 2: 9,952,090 T422I probably damaging Het
Tgs1 T C 4: 3,585,156 F99L probably damaging Het
Tox2 T C 2: 163,320,647 L479P probably damaging Het
Ttn A G 2: 76,766,875 I19898T probably damaging Het
Ulk1 G T 5: 110,789,046 T3N probably damaging Het
Vars A T 17: 35,013,881 K900N probably damaging Het
Vmn2r15 A G 5: 109,293,482 V170A possibly damaging Het
Vmn2r53 A T 7: 12,582,302 L530Q probably damaging Het
Zar1l G T 5: 150,518,063 Q33K probably benign Het
Zdhhc16 T C 19: 41,943,683 V358A possibly damaging Het
Other mutations in Cubn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00095:Cubn APN 2 13491820 unclassified probably benign
IGL00228:Cubn APN 2 13456697 missense probably damaging 1.00
IGL00231:Cubn APN 2 13381849 missense possibly damaging 0.89
IGL00327:Cubn APN 2 13427056 missense possibly damaging 0.73
IGL00470:Cubn APN 2 13278418 missense probably benign 0.00
IGL00519:Cubn APN 2 13282919 missense probably benign 0.00
IGL00562:Cubn APN 2 13294230 missense probably benign 0.01
IGL00678:Cubn APN 2 13467710 missense possibly damaging 0.47
IGL00834:Cubn APN 2 13381927 missense probably damaging 1.00
IGL00946:Cubn APN 2 13456623 missense probably damaging 0.98
IGL00971:Cubn APN 2 13278408 missense possibly damaging 0.77
IGL01124:Cubn APN 2 13478093 missense possibly damaging 0.62
IGL01287:Cubn APN 2 13310566 missense probably damaging 1.00
IGL01410:Cubn APN 2 13465908 missense probably benign 0.31
IGL01418:Cubn APN 2 13284041 missense probably benign 0.01
IGL01450:Cubn APN 2 13350862 splice site probably benign
IGL01534:Cubn APN 2 13465933 nonsense probably null
IGL01584:Cubn APN 2 13308661 splice site probably benign
IGL01595:Cubn APN 2 13325216 missense probably benign 0.05
IGL01625:Cubn APN 2 13306274 missense possibly damaging 0.76
IGL01732:Cubn APN 2 13489936 nonsense probably null
IGL01972:Cubn APN 2 13446072 missense possibly damaging 0.90
IGL02027:Cubn APN 2 13287594 missense probably damaging 1.00
IGL02033:Cubn APN 2 13339846 missense probably damaging 0.98
IGL02124:Cubn APN 2 13381837 missense probably damaging 0.99
IGL02335:Cubn APN 2 13427834 splice site probably null
IGL02491:Cubn APN 2 13321228 missense probably damaging 1.00
IGL02686:Cubn APN 2 13325226 missense possibly damaging 0.92
IGL02707:Cubn APN 2 13446032 missense probably damaging 0.99
IGL02746:Cubn APN 2 13445040 missense probably damaging 1.00
IGL02873:Cubn APN 2 13294370 missense probably benign 0.07
IGL02897:Cubn APN 2 13318312 missense possibly damaging 0.55
IGL03078:Cubn APN 2 13287094 missense possibly damaging 0.87
IGL03245:Cubn APN 2 13355689 missense probably benign 0.09
IGL03289:Cubn APN 2 13426967 missense probably benign 0.00
IGL03335:Cubn APN 2 13360329 missense probably damaging 1.00
IGL03355:Cubn APN 2 13478057 splice site probably null
mellow UTSW 2 13478078 missense probably damaging 1.00
PIT4354001:Cubn UTSW 2 13468852 nonsense probably null
PIT4495001:Cubn UTSW 2 13491750 missense probably benign 0.00
R0145:Cubn UTSW 2 13306432 missense probably damaging 1.00
R0220:Cubn UTSW 2 13356709 missense probably damaging 1.00
R0254:Cubn UTSW 2 13424694 missense probably benign 0.01
R0254:Cubn UTSW 2 13440514 missense possibly damaging 0.84
R0254:Cubn UTSW 2 13476035 critical splice donor site probably null
R0360:Cubn UTSW 2 13310507 splice site probably benign
R0364:Cubn UTSW 2 13310507 splice site probably benign
R0383:Cubn UTSW 2 13430959 missense probably damaging 1.00
R0419:Cubn UTSW 2 13469763 missense possibly damaging 0.77
R0419:Cubn UTSW 2 13469764 missense possibly damaging 0.87
R0498:Cubn UTSW 2 13444267 missense probably damaging 0.99
R0560:Cubn UTSW 2 13428680 missense probably damaging 1.00
R0615:Cubn UTSW 2 13360252 splice site probably null
R0735:Cubn UTSW 2 13491689 splice site probably benign
R0780:Cubn UTSW 2 13456613 missense probably damaging 1.00
R0899:Cubn UTSW 2 13362328 missense possibly damaging 0.54
R1118:Cubn UTSW 2 13336242 missense possibly damaging 0.78
R1182:Cubn UTSW 2 13445000 missense probably damaging 0.98
R1439:Cubn UTSW 2 13287568 missense probably damaging 0.96
R1450:Cubn UTSW 2 13360319 missense probably damaging 1.00
R1464:Cubn UTSW 2 13325288 missense possibly damaging 0.87
R1464:Cubn UTSW 2 13325288 missense possibly damaging 0.87
R1476:Cubn UTSW 2 13476120 missense probably benign 0.04
R1508:Cubn UTSW 2 13427105 missense probably benign 0.25
R1532:Cubn UTSW 2 13287661 missense probably damaging 1.00
R1562:Cubn UTSW 2 13427967 missense probably damaging 1.00
R1598:Cubn UTSW 2 13469789 missense probably benign 0.00
R1761:Cubn UTSW 2 13489317 critical splice donor site probably null
R1862:Cubn UTSW 2 13308561 missense probably damaging 1.00
R1874:Cubn UTSW 2 13323002 missense probably damaging 1.00
R1923:Cubn UTSW 2 13310526 missense probably damaging 1.00
R1944:Cubn UTSW 2 13278538 missense probably benign 0.01
R1960:Cubn UTSW 2 13340017 splice site probably null
R2021:Cubn UTSW 2 13308549 missense probably benign 0.09
R2137:Cubn UTSW 2 13336167 missense probably benign 0.01
R2138:Cubn UTSW 2 13444378 missense probably damaging 0.99
R2139:Cubn UTSW 2 13336167 missense probably benign 0.01
R2179:Cubn UTSW 2 13318242 missense possibly damaging 0.85
R2328:Cubn UTSW 2 13404080 nonsense probably null
R2369:Cubn UTSW 2 13491217 missense probably damaging 1.00
R2428:Cubn UTSW 2 13476150 missense probably damaging 1.00
R2435:Cubn UTSW 2 13318272 missense probably damaging 1.00
R2567:Cubn UTSW 2 13278356 splice site probably null
R2850:Cubn UTSW 2 13322953 missense probably damaging 1.00
R2853:Cubn UTSW 2 13430834 missense probably benign 0.00
R2893:Cubn UTSW 2 13358139 missense possibly damaging 0.61
R3107:Cubn UTSW 2 13362347 missense possibly damaging 0.73
R3109:Cubn UTSW 2 13362347 missense possibly damaging 0.73
R3119:Cubn UTSW 2 13358162 missense possibly damaging 0.90
R3405:Cubn UTSW 2 13333508 missense probably benign 0.00
R3703:Cubn UTSW 2 13350943 missense probably damaging 1.00
R3704:Cubn UTSW 2 13350943 missense probably damaging 1.00
R3705:Cubn UTSW 2 13350943 missense probably damaging 1.00
R3764:Cubn UTSW 2 13331585 missense possibly damaging 0.79
R3792:Cubn UTSW 2 13427914 missense probably damaging 1.00
R3802:Cubn UTSW 2 13360353 missense probably benign 0.01
R3813:Cubn UTSW 2 13294325 missense probably damaging 1.00
R3845:Cubn UTSW 2 13283008 missense probably damaging 1.00
R3846:Cubn UTSW 2 13283008 missense probably damaging 1.00
R3900:Cubn UTSW 2 13286980 critical splice donor site probably null
R3921:Cubn UTSW 2 13326677 missense probably damaging 1.00
R4075:Cubn UTSW 2 13313999 missense possibly damaging 0.58
R4082:Cubn UTSW 2 13428563 intron probably benign
R4405:Cubn UTSW 2 13466030 missense probably damaging 1.00
R4629:Cubn UTSW 2 13313979 splice site probably null
R4770:Cubn UTSW 2 13314767 missense possibly damaging 0.92
R4799:Cubn UTSW 2 13287024 missense possibly damaging 0.94
R4799:Cubn UTSW 2 13351058 missense probably damaging 1.00
R4812:Cubn UTSW 2 13459076 missense probably damaging 1.00
R4825:Cubn UTSW 2 13325225 missense probably damaging 1.00
R4934:Cubn UTSW 2 13489910 missense probably benign 0.06
R4967:Cubn UTSW 2 13348045 missense probably benign 0.01
R5187:Cubn UTSW 2 13287568 missense probably damaging 0.96
R5232:Cubn UTSW 2 13478202 nonsense probably null
R5305:Cubn UTSW 2 13388939 missense probably damaging 1.00
R5506:Cubn UTSW 2 13491695 splice site probably null
R5530:Cubn UTSW 2 13308523 missense probably damaging 1.00
R5531:Cubn UTSW 2 13350932 missense probably benign 0.00
R5737:Cubn UTSW 2 13388891 missense probably damaging 1.00
R5886:Cubn UTSW 2 13320023 splice site probably benign
R5923:Cubn UTSW 2 13486078 missense possibly damaging 0.73
R6032:Cubn UTSW 2 13325184 missense probably benign 0.12
R6032:Cubn UTSW 2 13325184 missense probably benign 0.12
R6084:Cubn UTSW 2 13430897 missense probably damaging 1.00
R6087:Cubn UTSW 2 13427847 missense probably damaging 1.00
R6133:Cubn UTSW 2 13308618 missense probably benign 0.29
R6181:Cubn UTSW 2 13349876 missense probably benign 0.31
R6301:Cubn UTSW 2 13478078 missense probably damaging 1.00
R6320:Cubn UTSW 2 13280195 missense probably damaging 1.00
R6368:Cubn UTSW 2 13430995 missense probably damaging 0.96
R6368:Cubn UTSW 2 13476123 missense probably damaging 0.98
R6383:Cubn UTSW 2 13427835 critical splice donor site probably null
R6393:Cubn UTSW 2 13355680 missense probably benign 0.08
R6408:Cubn UTSW 2 13294203 missense probably damaging 1.00
R6470:Cubn UTSW 2 13322993 missense possibly damaging 0.87
R6532:Cubn UTSW 2 13459002 missense probably benign 0.01
R6599:Cubn UTSW 2 13310673 missense possibly damaging 0.95
R6629:Cubn UTSW 2 13430872 missense probably damaging 1.00
R6641:Cubn UTSW 2 13476064 missense probably damaging 1.00
R6800:Cubn UTSW 2 13321255 missense probably damaging 1.00
R6823:Cubn UTSW 2 13445029 missense probably benign 0.21
R6847:Cubn UTSW 2 13444253 critical splice donor site probably null
R6885:Cubn UTSW 2 13318278 missense probably damaging 1.00
R6962:Cubn UTSW 2 13348029 missense probably benign 0.03
R6973:Cubn UTSW 2 13381837 missense possibly damaging 0.61
R6975:Cubn UTSW 2 13486789 missense probably damaging 0.99
R7076:Cubn UTSW 2 13306280 missense probably benign 0.00
R7076:Cubn UTSW 2 13306281 missense probably benign 0.10
R7086:Cubn UTSW 2 13319858 missense probably damaging 0.98
R7162:Cubn UTSW 2 13342498 missense probably damaging 0.96
R7203:Cubn UTSW 2 13351003 missense probably benign 0.01
R7292:Cubn UTSW 2 13424739 missense probably damaging 0.99
R7307:Cubn UTSW 2 13340332 missense probably damaging 0.99
R7329:Cubn UTSW 2 13468771 missense probably damaging 0.99
R7395:Cubn UTSW 2 13287064 missense probably damaging 1.00
R7417:Cubn UTSW 2 13426967 missense probably benign 0.00
R7429:Cubn UTSW 2 13322993 missense possibly damaging 0.87
R7430:Cubn UTSW 2 13322993 missense possibly damaging 0.87
R7443:Cubn UTSW 2 13455509 missense probably damaging 1.00
X0018:Cubn UTSW 2 13458986 missense probably damaging 1.00
X0022:Cubn UTSW 2 13476076 missense probably damaging 1.00
X0026:Cubn UTSW 2 13342581 missense probably damaging 1.00
X0063:Cubn UTSW 2 13322962 missense probably damaging 1.00
YA93:Cubn UTSW 2 13383992 missense probably benign 0.21
Z1088:Cubn UTSW 2 13294229 missense probably benign 0.43
Predicted Primers PCR Primer
(F):5'- AAACACGATCAGCTTGGTTTCTC -3'
(R):5'- CAAGGTCATGCAAATCGTAGTTAG -3'

Sequencing Primer
(F):5'- CTCCAGGAAAATGTAAGATCCTTGC -3'
(R):5'- TCGTAGTTAGTAAAGAACTGAGACC -3'
Posted On2015-09-25