Incidental Mutation 'R4615:Slc17a9'
ID345004
Institutional Source Beutler Lab
Gene Symbol Slc17a9
Ensembl Gene ENSMUSG00000023393
Gene Namesolute carrier family 17, member 9
Synonyms1700019H03Rik, Vnut
MMRRC Submission 041826-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4615 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location180725263-180742280 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 180731906 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 40 (I40T)
Ref Sequence ENSEMBL: ENSMUSP00000091771 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094218]
Predicted Effect probably benign
Transcript: ENSMUST00000094218
AA Change: I40T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000091771
Gene: ENSMUSG00000023393
AA Change: I40T

DomainStartEndE-ValueType
Pfam:MFS_1 40 398 2.3e-53 PFAM
transmembrane domain 411 433 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139817
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151882
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154882
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of transmembrane proteins that are involved in the transport of small molecules. The encoded protein participates in the vesicular uptake, storage, and secretion of adenoside triphosphate (ATP) and other nucleotides. A mutation in this gene was found in individuals with autosomal dominant disseminated superficial actinic porokeratosis-8. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2014]
PHENOTYPE: Homozygous knockout affects the neuroendocrine system, resulting in hypoglycemia, increased glucose tolerance and increased insulin sensitivity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 T C 1: 71,330,334 I363V probably benign Het
Abcc9 C G 6: 142,689,107 A144P possibly damaging Het
Adgrv1 C T 13: 81,494,569 probably null Het
Adprhl1 A G 8: 13,242,250 probably null Het
Angptl3 A T 4: 99,031,361 E119D probably benign Het
Atp8b1 T C 18: 64,553,099 N671S probably null Het
C9 A G 15: 6,491,463 D51G probably damaging Het
Carmil2 A G 8: 105,695,074 D1019G possibly damaging Het
Cdh8 A T 8: 99,279,622 I111K probably damaging Het
Cep120 T C 18: 53,714,841 R649G probably damaging Het
Clptm1l A T 13: 73,607,738 K158* probably null Het
Cmtm1 CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT 8: 104,309,470 probably benign Het
Cnga1 A C 5: 72,604,774 L466V probably damaging Het
Cpsf1 T C 15: 76,596,937 T1240A possibly damaging Het
Cubn A G 2: 13,428,749 S1117P probably damaging Het
Cyp2b9 T A 7: 26,201,125 L396Q probably damaging Het
Cyp8b1 A T 9: 121,916,098 L56* probably null Het
Dcbld2 A G 16: 58,456,094 T458A probably benign Het
Dio2 G T 12: 90,729,821 P131Q probably damaging Het
Dlg5 T C 14: 24,158,168 Y990C probably damaging Het
Dsc3 T C 18: 19,971,488 D594G possibly damaging Het
Dsp A G 13: 38,191,632 E1131G probably damaging Het
Fdx1 A T 9: 51,948,645 Y21* probably null Het
Gal3st4 A G 5: 138,266,263 V158A probably damaging Het
Gm10269 T A 18: 20,682,763 E67D probably benign Het
Gm5773 A G 3: 93,774,032 H337R probably benign Het
Gm7102 C T 19: 61,175,926 G24R unknown Het
Gng2 C T 14: 19,891,327 V16I possibly damaging Het
Gpr20 T C 15: 73,695,736 N268S probably benign Het
Ighv1-82 T C 12: 115,952,660 T77A probably benign Het
Lama2 C A 10: 26,981,524 V3110F probably damaging Het
Mtmr4 T C 11: 87,610,935 L548S probably damaging Het
Ncapg A T 5: 45,687,399 M579L probably benign Het
Olfr1338 T C 4: 118,754,137 T134A probably benign Het
Olfr292 T C 7: 86,694,728 S91P probably damaging Het
Oog3 A T 4: 144,158,329 Y346N probably benign Het
Orm2 A G 4: 63,363,299 D89G probably damaging Het
Pcdhb4 T A 18: 37,308,500 S288T probably benign Het
Pcsk2 G T 2: 143,795,969 C375F probably damaging Het
Pdcd10 T C 3: 75,521,091 I138M probably damaging Het
Pde8a T C 7: 81,320,737 W536R probably damaging Het
Phkg2 C T 7: 127,577,620 R61W probably damaging Het
Plcl1 A T 1: 55,698,134 N878I probably benign Het
Prkdc A T 16: 15,663,074 D353V probably damaging Het
Psme4 C T 11: 30,834,287 T954I probably benign Het
Ran A G 5: 129,022,098 I115V probably benign Het
Reln A G 5: 21,972,872 L1867P possibly damaging Het
S100a1 A G 3: 90,511,255 V84A possibly damaging Het
Sall2 G A 14: 52,312,750 P994L probably benign Het
Shtn1 A T 19: 59,022,216 I273N probably benign Het
Slc29a2 T C 19: 5,029,264 V305A probably damaging Het
Ssfa2 A G 2: 79,662,382 E1091G probably damaging Het
Taar2 T A 10: 23,941,365 F268I probably benign Het
Taf3 G A 2: 9,952,090 T422I probably damaging Het
Tgs1 T C 4: 3,585,156 F99L probably damaging Het
Tox2 T C 2: 163,320,647 L479P probably damaging Het
Ttn A G 2: 76,766,875 I19898T probably damaging Het
Ulk1 G T 5: 110,789,046 T3N probably damaging Het
Vars A T 17: 35,013,881 K900N probably damaging Het
Vmn2r15 A G 5: 109,293,482 V170A possibly damaging Het
Vmn2r53 A T 7: 12,582,302 L530Q probably damaging Het
Zar1l G T 5: 150,518,063 Q33K probably benign Het
Zdhhc16 T C 19: 41,943,683 V358A possibly damaging Het
Other mutations in Slc17a9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02110:Slc17a9 APN 2 180732576 splice site probably benign
IGL02334:Slc17a9 APN 2 180740743 critical splice donor site probably null
IGL02383:Slc17a9 APN 2 180735881 missense probably benign 0.29
IGL02685:Slc17a9 APN 2 180733809 missense probably damaging 0.98
IGL03025:Slc17a9 APN 2 180739816 splice site probably null
IGL03338:Slc17a9 APN 2 180740518 splice site probably benign
R2219:Slc17a9 UTSW 2 180731962 missense probably benign
R4921:Slc17a9 UTSW 2 180735949 missense probably benign 0.00
R6150:Slc17a9 UTSW 2 180737628 missense probably benign 0.00
R6217:Slc17a9 UTSW 2 180737662 missense probably benign 0.12
R7342:Slc17a9 UTSW 2 180736762 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTATTAACCTGCCGAAATCCCC -3'
(R):5'- CAGGTGATGGTAATGATCCCC -3'

Sequencing Primer
(F):5'- ATCCCCACCGAAGAAGTTATC -3'
(R):5'- GTGATGGTAATGATCCCCCTCAG -3'
Posted On2015-09-25