Incidental Mutation 'R4615:Angptl3'
ID345010
Institutional Source Beutler Lab
Gene Symbol Angptl3
Ensembl Gene ENSMUSG00000028553
Gene Nameangiopoietin-like 3
Synonymshypl
MMRRC Submission 041826-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.172) question?
Stock #R4615 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location99030954-99046111 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 99031361 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 119 (E119D)
Ref Sequence ENSEMBL: ENSMUSP00000030280 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030280] [ENSMUST00000030286] [ENSMUST00000075836] [ENSMUST00000127417] [ENSMUST00000205650]
Predicted Effect probably benign
Transcript: ENSMUST00000030280
AA Change: E119D

PolyPhen 2 Score 0.031 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000030280
Gene: ENSMUSG00000028553
AA Change: E119D

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
low complexity region 119 131 N/A INTRINSIC
Blast:FBG 195 240 6e-8 BLAST
FBG 241 454 1.5e-58 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000030286
SMART Domains Protein: ENSMUSP00000030286
Gene: ENSMUSG00000028556

DomainStartEndE-ValueType
Pfam:DUF3398 67 159 6.5e-30 PFAM
coiled coil region 367 394 N/A INTRINSIC
low complexity region 493 504 N/A INTRINSIC
Pfam:DOCK-C2 557 736 1.8e-51 PFAM
low complexity region 789 799 N/A INTRINSIC
low complexity region 862 873 N/A INTRINSIC
low complexity region 888 901 N/A INTRINSIC
low complexity region 1135 1163 N/A INTRINSIC
low complexity region 1350 1364 N/A INTRINSIC
low complexity region 1543 1565 N/A INTRINSIC
Pfam:DHR-2 1571 2095 1.4e-217 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000075836
SMART Domains Protein: ENSMUSP00000075233
Gene: ENSMUSG00000028556

DomainStartEndE-ValueType
Pfam:DUF3398 65 159 5.8e-34 PFAM
coiled coil region 367 394 N/A INTRINSIC
low complexity region 493 504 N/A INTRINSIC
Pfam:DOCK-C2 556 737 3.3e-58 PFAM
low complexity region 789 799 N/A INTRINSIC
low complexity region 862 873 N/A INTRINSIC
low complexity region 888 901 N/A INTRINSIC
low complexity region 1105 1133 N/A INTRINSIC
low complexity region 1320 1334 N/A INTRINSIC
low complexity region 1513 1535 N/A INTRINSIC
Pfam:Ded_cyto 1888 2065 6.5e-80 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125546
Predicted Effect probably benign
Transcript: ENSMUST00000127417
SMART Domains Protein: ENSMUSP00000117797
Gene: ENSMUSG00000028556

DomainStartEndE-ValueType
low complexity region 140 162 N/A INTRINSIC
Pfam:Ded_cyto 517 694 3e-80 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000131386
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136091
Predicted Effect probably benign
Transcript: ENSMUST00000205650
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the angiopoietin-like family of proteins. The encoded preproprotein is proteolytically processed to generate multiple protein products, which may inhibit triglyceride metabolism. Homozygous knockout mice for this gene exhibit reduced plasma lipid concentrations, including reduced plasma triglyceride concentrations, and enhanced activity of enzymes involved in triglyceride metabolism. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygous for a disruption in this gene display decreased plasma cholesterol and triglyceride levels. A spontaneous mutation results in a similar phenotype except that there is also a reduction in fat pad weight and decreased free fatty acid levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 T C 1: 71,330,334 I363V probably benign Het
Abcc9 C G 6: 142,689,107 A144P possibly damaging Het
Adgrv1 C T 13: 81,494,569 probably null Het
Adprhl1 A G 8: 13,242,250 probably null Het
Atp8b1 T C 18: 64,553,099 N671S probably null Het
C9 A G 15: 6,491,463 D51G probably damaging Het
Carmil2 A G 8: 105,695,074 D1019G possibly damaging Het
Cdh8 A T 8: 99,279,622 I111K probably damaging Het
Cep120 T C 18: 53,714,841 R649G probably damaging Het
Clptm1l A T 13: 73,607,738 K158* probably null Het
Cmtm1 CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT 8: 104,309,470 probably benign Het
Cnga1 A C 5: 72,604,774 L466V probably damaging Het
Cpsf1 T C 15: 76,596,937 T1240A possibly damaging Het
Cubn A G 2: 13,428,749 S1117P probably damaging Het
Cyp2b9 T A 7: 26,201,125 L396Q probably damaging Het
Cyp8b1 A T 9: 121,916,098 L56* probably null Het
Dcbld2 A G 16: 58,456,094 T458A probably benign Het
Dio2 G T 12: 90,729,821 P131Q probably damaging Het
Dlg5 T C 14: 24,158,168 Y990C probably damaging Het
Dsc3 T C 18: 19,971,488 D594G possibly damaging Het
Dsp A G 13: 38,191,632 E1131G probably damaging Het
Fdx1 A T 9: 51,948,645 Y21* probably null Het
Gal3st4 A G 5: 138,266,263 V158A probably damaging Het
Gm10269 T A 18: 20,682,763 E67D probably benign Het
Gm5773 A G 3: 93,774,032 H337R probably benign Het
Gm7102 C T 19: 61,175,926 G24R unknown Het
Gng2 C T 14: 19,891,327 V16I possibly damaging Het
Gpr20 T C 15: 73,695,736 N268S probably benign Het
Ighv1-82 T C 12: 115,952,660 T77A probably benign Het
Lama2 C A 10: 26,981,524 V3110F probably damaging Het
Mtmr4 T C 11: 87,610,935 L548S probably damaging Het
Ncapg A T 5: 45,687,399 M579L probably benign Het
Olfr1338 T C 4: 118,754,137 T134A probably benign Het
Olfr292 T C 7: 86,694,728 S91P probably damaging Het
Oog3 A T 4: 144,158,329 Y346N probably benign Het
Orm2 A G 4: 63,363,299 D89G probably damaging Het
Pcdhb4 T A 18: 37,308,500 S288T probably benign Het
Pcsk2 G T 2: 143,795,969 C375F probably damaging Het
Pdcd10 T C 3: 75,521,091 I138M probably damaging Het
Pde8a T C 7: 81,320,737 W536R probably damaging Het
Phkg2 C T 7: 127,577,620 R61W probably damaging Het
Plcl1 A T 1: 55,698,134 N878I probably benign Het
Prkdc A T 16: 15,663,074 D353V probably damaging Het
Psme4 C T 11: 30,834,287 T954I probably benign Het
Ran A G 5: 129,022,098 I115V probably benign Het
Reln A G 5: 21,972,872 L1867P possibly damaging Het
S100a1 A G 3: 90,511,255 V84A possibly damaging Het
Sall2 G A 14: 52,312,750 P994L probably benign Het
Shtn1 A T 19: 59,022,216 I273N probably benign Het
Slc17a9 T C 2: 180,731,906 I40T probably benign Het
Slc29a2 T C 19: 5,029,264 V305A probably damaging Het
Ssfa2 A G 2: 79,662,382 E1091G probably damaging Het
Taar2 T A 10: 23,941,365 F268I probably benign Het
Taf3 G A 2: 9,952,090 T422I probably damaging Het
Tgs1 T C 4: 3,585,156 F99L probably damaging Het
Tox2 T C 2: 163,320,647 L479P probably damaging Het
Ttn A G 2: 76,766,875 I19898T probably damaging Het
Ulk1 G T 5: 110,789,046 T3N probably damaging Het
Vars A T 17: 35,013,881 K900N probably damaging Het
Vmn2r15 A G 5: 109,293,482 V170A possibly damaging Het
Vmn2r53 A T 7: 12,582,302 L530Q probably damaging Het
Zar1l G T 5: 150,518,063 Q33K probably benign Het
Zdhhc16 T C 19: 41,943,683 V358A possibly damaging Het
Other mutations in Angptl3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00583:Angptl3 APN 4 99034840 missense probably damaging 0.99
IGL01859:Angptl3 APN 4 99037432 nonsense probably null
IGL02126:Angptl3 APN 4 99031501 critical splice donor site probably null
IGL02134:Angptl3 APN 4 99031112 missense probably damaging 1.00
IGL02573:Angptl3 APN 4 99037934 missense probably damaging 1.00
IGL02756:Angptl3 APN 4 99031162 missense probably damaging 1.00
IGL03369:Angptl3 APN 4 99034820 intron probably benign
R0309:Angptl3 UTSW 4 99034469 missense probably benign 0.32
R0549:Angptl3 UTSW 4 99031455 missense probably benign 0.00
R0675:Angptl3 UTSW 4 99033262 missense probably benign 0.02
R1465:Angptl3 UTSW 4 99037520 missense probably benign 0.01
R1465:Angptl3 UTSW 4 99037520 missense probably benign 0.01
R1738:Angptl3 UTSW 4 99033262 missense probably benign 0.02
R2007:Angptl3 UTSW 4 99037397 missense probably damaging 0.99
R2656:Angptl3 UTSW 4 99037964 missense probably benign 0.01
R3436:Angptl3 UTSW 4 99033303 missense probably benign 0.24
R3437:Angptl3 UTSW 4 99033303 missense probably benign 0.24
R3615:Angptl3 UTSW 4 99034465 missense probably benign 0.06
R3616:Angptl3 UTSW 4 99034465 missense probably benign 0.06
R4161:Angptl3 UTSW 4 99031491 missense probably damaging 0.99
R4534:Angptl3 UTSW 4 99037995 missense possibly damaging 0.73
R4835:Angptl3 UTSW 4 99037412 missense probably benign 0.36
R5308:Angptl3 UTSW 4 99034486 missense probably benign 0.33
R5413:Angptl3 UTSW 4 99031022 missense probably benign 0.12
R5668:Angptl3 UTSW 4 99032084 critical splice acceptor site probably null
R5906:Angptl3 UTSW 4 99037567 missense probably benign 0.07
R6520:Angptl3 UTSW 4 99037848 missense probably benign 0.35
R6544:Angptl3 UTSW 4 99031438 missense probably damaging 1.00
R6762:Angptl3 UTSW 4 99037417 missense possibly damaging 0.91
Z1088:Angptl3 UTSW 4 99034520 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AAAATTTTAGCGAATGGCCTCC -3'
(R):5'- TGAAAACAATCAGAGTGCTGTG -3'

Sequencing Primer
(F):5'- TTAGCGAATGGCCTCCTGCAG -3'
(R):5'- CAGAGTGCTGTGATTTCTACTTAC -3'
Posted On2015-09-25