Incidental Mutation 'R4615:Olfr1338'
ID345011
Institutional Source Beutler Lab
Gene Symbol Olfr1338
Ensembl Gene ENSMUSG00000095218
Gene Nameolfactory receptor 1338
SynonymsMOR259-9, GA_x6K02T2QD9B-18795136-18796077, MOR259-4P, MOR259-4P, Olfr1524-ps1
MMRRC Submission 041826-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.531) question?
Stock #R4615 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location118751975-118758737 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 118754137 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 134 (T134A)
Ref Sequence ENSEMBL: ENSMUSP00000092427 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084315] [ENSMUST00000214922] [ENSMUST00000216559]
Predicted Effect probably benign
Transcript: ENSMUST00000084315
AA Change: T134A

PolyPhen 2 Score 0.337 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000092427
Gene: ENSMUSG00000095218
AA Change: T134A

DomainStartEndE-ValueType
Pfam:7tm_4 32 308 3.3e-55 PFAM
Pfam:7TM_GPCR_Srsx 36 306 1e-8 PFAM
Pfam:7tm_1 42 291 1.8e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000214922
AA Change: T136A

PolyPhen 2 Score 0.289 (Sensitivity: 0.91; Specificity: 0.88)
Predicted Effect probably benign
Transcript: ENSMUST00000216559
AA Change: T136A

PolyPhen 2 Score 0.289 (Sensitivity: 0.91; Specificity: 0.88)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 T C 1: 71,330,334 I363V probably benign Het
Abcc9 C G 6: 142,689,107 A144P possibly damaging Het
Adgrv1 C T 13: 81,494,569 probably null Het
Adprhl1 A G 8: 13,242,250 probably null Het
Angptl3 A T 4: 99,031,361 E119D probably benign Het
Atp8b1 T C 18: 64,553,099 N671S probably null Het
C9 A G 15: 6,491,463 D51G probably damaging Het
Carmil2 A G 8: 105,695,074 D1019G possibly damaging Het
Cdh8 A T 8: 99,279,622 I111K probably damaging Het
Cep120 T C 18: 53,714,841 R649G probably damaging Het
Clptm1l A T 13: 73,607,738 K158* probably null Het
Cmtm1 CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT 8: 104,309,470 probably benign Het
Cnga1 A C 5: 72,604,774 L466V probably damaging Het
Cpsf1 T C 15: 76,596,937 T1240A possibly damaging Het
Cubn A G 2: 13,428,749 S1117P probably damaging Het
Cyp2b9 T A 7: 26,201,125 L396Q probably damaging Het
Cyp8b1 A T 9: 121,916,098 L56* probably null Het
Dcbld2 A G 16: 58,456,094 T458A probably benign Het
Dio2 G T 12: 90,729,821 P131Q probably damaging Het
Dlg5 T C 14: 24,158,168 Y990C probably damaging Het
Dsc3 T C 18: 19,971,488 D594G possibly damaging Het
Dsp A G 13: 38,191,632 E1131G probably damaging Het
Fdx1 A T 9: 51,948,645 Y21* probably null Het
Gal3st4 A G 5: 138,266,263 V158A probably damaging Het
Gm10269 T A 18: 20,682,763 E67D probably benign Het
Gm5773 A G 3: 93,774,032 H337R probably benign Het
Gm7102 C T 19: 61,175,926 G24R unknown Het
Gng2 C T 14: 19,891,327 V16I possibly damaging Het
Gpr20 T C 15: 73,695,736 N268S probably benign Het
Ighv1-82 T C 12: 115,952,660 T77A probably benign Het
Lama2 C A 10: 26,981,524 V3110F probably damaging Het
Mtmr4 T C 11: 87,610,935 L548S probably damaging Het
Ncapg A T 5: 45,687,399 M579L probably benign Het
Olfr292 T C 7: 86,694,728 S91P probably damaging Het
Oog3 A T 4: 144,158,329 Y346N probably benign Het
Orm2 A G 4: 63,363,299 D89G probably damaging Het
Pcdhb4 T A 18: 37,308,500 S288T probably benign Het
Pcsk2 G T 2: 143,795,969 C375F probably damaging Het
Pdcd10 T C 3: 75,521,091 I138M probably damaging Het
Pde8a T C 7: 81,320,737 W536R probably damaging Het
Phkg2 C T 7: 127,577,620 R61W probably damaging Het
Plcl1 A T 1: 55,698,134 N878I probably benign Het
Prkdc A T 16: 15,663,074 D353V probably damaging Het
Psme4 C T 11: 30,834,287 T954I probably benign Het
Ran A G 5: 129,022,098 I115V probably benign Het
Reln A G 5: 21,972,872 L1867P possibly damaging Het
S100a1 A G 3: 90,511,255 V84A possibly damaging Het
Sall2 G A 14: 52,312,750 P994L probably benign Het
Shtn1 A T 19: 59,022,216 I273N probably benign Het
Slc17a9 T C 2: 180,731,906 I40T probably benign Het
Slc29a2 T C 19: 5,029,264 V305A probably damaging Het
Ssfa2 A G 2: 79,662,382 E1091G probably damaging Het
Taar2 T A 10: 23,941,365 F268I probably benign Het
Taf3 G A 2: 9,952,090 T422I probably damaging Het
Tgs1 T C 4: 3,585,156 F99L probably damaging Het
Tox2 T C 2: 163,320,647 L479P probably damaging Het
Ttn A G 2: 76,766,875 I19898T probably damaging Het
Ulk1 G T 5: 110,789,046 T3N probably damaging Het
Vars A T 17: 35,013,881 K900N probably damaging Het
Vmn2r15 A G 5: 109,293,482 V170A possibly damaging Het
Vmn2r53 A T 7: 12,582,302 L530Q probably damaging Het
Zar1l G T 5: 150,518,063 Q33K probably benign Het
Zdhhc16 T C 19: 41,943,683 V358A possibly damaging Het
Other mutations in Olfr1338
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01092:Olfr1338 APN 4 118753762 missense possibly damaging 0.78
IGL02726:Olfr1338 APN 4 118753764 missense probably benign 0.00
IGL02928:Olfr1338 APN 4 118754500 missense probably damaging 1.00
IGL03102:Olfr1338 APN 4 118753934 missense probably benign 0.00
R0062:Olfr1338 UTSW 4 118753903 missense probably benign 0.00
R0062:Olfr1338 UTSW 4 118753903 missense probably benign 0.00
R0299:Olfr1338 UTSW 4 118754535 start codon destroyed probably null 0.82
R0501:Olfr1338 UTSW 4 118753830 missense probably benign 0.00
R1301:Olfr1338 UTSW 4 118753619 missense probably benign
R1719:Olfr1338 UTSW 4 118753600 missense possibly damaging 0.78
R2327:Olfr1338 UTSW 4 118754134 missense probably benign 0.13
R3110:Olfr1338 UTSW 4 118754224 missense probably damaging 0.99
R3112:Olfr1338 UTSW 4 118754224 missense probably damaging 0.99
R4582:Olfr1338 UTSW 4 118753893 missense probably damaging 1.00
R5640:Olfr1338 UTSW 4 118753789 missense probably benign 0.07
R6513:Olfr1338 UTSW 4 118754027 nonsense probably null
R6889:Olfr1338 UTSW 4 118754307 missense probably damaging 0.99
R7157:Olfr1338 UTSW 4 118754418 missense possibly damaging 0.93
R7168:Olfr1338 UTSW 4 118753851 missense probably damaging 0.98
R7378:Olfr1338 UTSW 4 118754175 missense possibly damaging 0.74
R7451:Olfr1338 UTSW 4 118753687 missense probably benign 0.03
R7770:Olfr1338 UTSW 4 118754057 missense probably benign 0.04
R7847:Olfr1338 UTSW 4 118754368 missense possibly damaging 0.79
Predicted Primers PCR Primer
(F):5'- TCCATGCAAGCCAGACTACG -3'
(R):5'- ACAGCTGCACACTCCTATGTAC -3'

Sequencing Primer
(F):5'- GACTACGCACTGAAGGACCTTC -3'
(R):5'- TGGATATGAGCTATGTCACTACCACC -3'
Posted On2015-09-25