Mutagenetix > Incidental Mutation

Incidental Mutation 'R4615:Reln'

345013

Institutional Source

Beutler Lab

Gene Symbol

Reln

Ensembl Gene

ENSMUSG00000042453

Gene Name

reelin

Synonyms

MMRRC Submission

041826-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.958) question?

Stock #

R4615 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

21884454-22344702 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 21972872 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Proline at position 1867 (L1867P)

Ref Sequence

ENSEMBL: ENSMUSP00000124052 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000062372] [ENSMUST00000161356]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000062372
AA Change: L1867P

PolyPhen 2 Score 0.954 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000058025
Gene: ENSMUSG00000042453
AA Change: L1867P

Domain	Start	End	E-Value	Type
signal peptide	1	26	N/A	INTRINSIC
Pfam:Reeler	40	172	6.1e-24	PFAM
internal_repeat_3	195	360	5.04e-6	PROSPERO
EGF	674	702	1.2e1	SMART
EGF_like	1033	1061	6.95e1	SMART
EGF	1412	1442	6.02e0	SMART
EGF_like	1768	1796	2.92e1	SMART
low complexity region	1939	1948	N/A	INTRINSIC
low complexity region	2062	2071	N/A	INTRINSIC
EGF	2132	2161	1.43e-1	SMART
EGF_like	2481	2509	3.43e1	SMART
EGF	2856	2884	2.2e1	SMART
EGF	3231	3260	3.46e0	SMART
low complexity region	3450	3457	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000161353

Predicted Effect

possibly damaging
Transcript: ENSMUST00000161356
AA Change: L1867P

PolyPhen 2 Score 0.954 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000124052
Gene: ENSMUSG00000042453
AA Change: L1867P

Domain	Start	End	E-Value	Type
signal peptide	1	26	N/A	INTRINSIC
Pfam:Reeler	54	171	2.9e-10	PFAM
internal_repeat_3	195	360	5.06e-6	PROSPERO
internal_repeat_2	207	413	3.41e-11	PROSPERO
EGF	674	702	1.2e1	SMART
EGF_like	1033	1061	6.95e1	SMART
EGF	1412	1442	6.02e0	SMART
internal_repeat_2	1452	1660	3.41e-11	PROSPERO
EGF_like	1768	1796	2.92e1	SMART
low complexity region	1939	1948	N/A	INTRINSIC
low complexity region	2062	2071	N/A	INTRINSIC
EGF	2132	2161	1.43e-1	SMART
EGF_like	2481	2509	3.43e1	SMART
EGF	2856	2884	2.2e1	SMART
EGF	3231	3260	3.46e0	SMART
low complexity region	3452	3459	N/A	INTRINSIC

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 95.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large secreted extracellular matrix protein thought to control cell-cell interactions critical for cell positioning and neuronal migration during brain development. This protein may be involved in schizophrenia, autism, bipolar disorder, major depression and in migration defects associated with temporal lobe epilepsy. Mutations of this gene are associated with autosomal recessive lissencephaly with cerebellar hypoplasia. Two transcript variants encoding distinct isoforms have been identified for this gene. Other transcript variants have been described but their full length nature has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for most spontaneous or ENU-induced mutations show impaired righting responses, ataxia, tremors, and cerebellum and hippocampus abnormalities. Some mutants show postnatal or premature death and decreased body size while others have abnormal retinas or olfactory bulbs or infertility. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca12	T	C	1: 71,330,334	I363V	probably benign	Het
Abcc9	C	G	6: 142,689,107	A144P	possibly damaging	Het
Adgrv1	C	T	13: 81,494,569		probably null	Het
Adprhl1	A	G	8: 13,242,250		probably null	Het
Angptl3	A	T	4: 99,031,361	E119D	probably benign	Het
Atp8b1	T	C	18: 64,553,099	N671S	probably null	Het
C9	A	G	15: 6,491,463	D51G	probably damaging	Het
Carmil2	A	G	8: 105,695,074	D1019G	possibly damaging	Het
Cdh8	A	T	8: 99,279,622	I111K	probably damaging	Het
Cep120	T	C	18: 53,714,841	R649G	probably damaging	Het
Clptm1l	A	T	13: 73,607,738	K158*	probably null	Het
Cmtm1	CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT	CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT	8: 104,309,470		probably benign	Het
Cnga1	A	C	5: 72,604,774	L466V	probably damaging	Het
Cpsf1	T	C	15: 76,596,937	T1240A	possibly damaging	Het
Cubn	A	G	2: 13,428,749	S1117P	probably damaging	Het
Cyp2b9	T	A	7: 26,201,125	L396Q	probably damaging	Het
Cyp8b1	A	T	9: 121,916,098	L56*	probably null	Het
Dcbld2	A	G	16: 58,456,094	T458A	probably benign	Het
Dio2	G	T	12: 90,729,821	P131Q	probably damaging	Het
Dlg5	T	C	14: 24,158,168	Y990C	probably damaging	Het
Dsc3	T	C	18: 19,971,488	D594G	possibly damaging	Het
Dsp	A	G	13: 38,191,632	E1131G	probably damaging	Het
Fdx1	A	T	9: 51,948,645	Y21*	probably null	Het
Gal3st4	A	G	5: 138,266,263	V158A	probably damaging	Het
Gm10269	T	A	18: 20,682,763	E67D	probably benign	Het
Gm5773	A	G	3: 93,774,032	H337R	probably benign	Het
Gm7102	C	T	19: 61,175,926	G24R	unknown	Het
Gng2	C	T	14: 19,891,327	V16I	possibly damaging	Het
Gpr20	T	C	15: 73,695,736	N268S	probably benign	Het
Ighv1-82	T	C	12: 115,952,660	T77A	probably benign	Het
Lama2	C	A	10: 26,981,524	V3110F	probably damaging	Het
Mtmr4	T	C	11: 87,610,935	L548S	probably damaging	Het
Ncapg	A	T	5: 45,687,399	M579L	probably benign	Het
Olfr1338	T	C	4: 118,754,137	T134A	probably benign	Het
Olfr292	T	C	7: 86,694,728	S91P	probably damaging	Het
Oog3	A	T	4: 144,158,329	Y346N	probably benign	Het
Orm2	A	G	4: 63,363,299	D89G	probably damaging	Het
Pcdhb4	T	A	18: 37,308,500	S288T	probably benign	Het
Pcsk2	G	T	2: 143,795,969	C375F	probably damaging	Het
Pdcd10	T	C	3: 75,521,091	I138M	probably damaging	Het
Pde8a	T	C	7: 81,320,737	W536R	probably damaging	Het
Phkg2	C	T	7: 127,577,620	R61W	probably damaging	Het
Plcl1	A	T	1: 55,698,134	N878I	probably benign	Het
Prkdc	A	T	16: 15,663,074	D353V	probably damaging	Het
Psme4	C	T	11: 30,834,287	T954I	probably benign	Het
Ran	A	G	5: 129,022,098	I115V	probably benign	Het
S100a1	A	G	3: 90,511,255	V84A	possibly damaging	Het
Sall2	G	A	14: 52,312,750	P994L	probably benign	Het
Shtn1	A	T	19: 59,022,216	I273N	probably benign	Het
Slc17a9	T	C	2: 180,731,906	I40T	probably benign	Het
Slc29a2	T	C	19: 5,029,264	V305A	probably damaging	Het
Ssfa2	A	G	2: 79,662,382	E1091G	probably damaging	Het
Taar2	T	A	10: 23,941,365	F268I	probably benign	Het
Taf3	G	A	2: 9,952,090	T422I	probably damaging	Het
Tgs1	T	C	4: 3,585,156	F99L	probably damaging	Het
Tox2	T	C	2: 163,320,647	L479P	probably damaging	Het
Ttn	A	G	2: 76,766,875	I19898T	probably damaging	Het
Ulk1	G	T	5: 110,789,046	T3N	probably damaging	Het
Vars	A	T	17: 35,013,881	K900N	probably damaging	Het
Vmn2r15	A	G	5: 109,293,482	V170A	possibly damaging	Het
Vmn2r53	A	T	7: 12,582,302	L530Q	probably damaging	Het
Zar1l	G	T	5: 150,518,063	Q33K	probably benign	Het
Zdhhc16	T	C	19: 41,943,683	V358A	possibly damaging	Het

Other mutations in Reln

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00090:Reln	APN	5	22,039,565 (GRCm38)	missense	possibly damaging	0.57
IGL00091:Reln	APN	5	22,039,565 (GRCm38)	missense	possibly damaging	0.57
IGL00432:Reln	APN	5	22,010,127 (GRCm38)	missense	probably damaging	1.00
IGL00433:Reln	APN	5	22,045,009 (GRCm38)	missense	probably damaging	1.00
IGL00576:Reln	APN	5	22,154,950 (GRCm38)	missense	probably benign	0.01
IGL00755:Reln	APN	5	22,060,380 (GRCm38)	missense	probably damaging	0.98
IGL00777:Reln	APN	5	22,018,850 (GRCm38)	critical splice donor site	probably null
IGL00900:Reln	APN	5	21,980,117 (GRCm38)	missense	probably damaging	0.98
IGL01067:Reln	APN	5	21,979,666 (GRCm38)	missense	probably damaging	1.00
IGL01104:Reln	APN	5	21,986,967 (GRCm38)	missense	probably damaging	0.99
IGL01141:Reln	APN	5	21,969,033 (GRCm38)	missense	probably damaging	1.00
IGL01141:Reln	APN	5	21,919,069 (GRCm38)	missense	probably damaging	1.00
IGL01333:Reln	APN	5	22,171,251 (GRCm38)	missense	probably damaging	0.99
IGL01341:Reln	APN	5	21,969,079 (GRCm38)	missense	probably damaging	1.00
IGL01354:Reln	APN	5	21,919,175 (GRCm38)	nonsense	probably null
IGL01361:Reln	APN	5	21,919,021 (GRCm38)	missense	probably benign	0.06
IGL01446:Reln	APN	5	21,969,317 (GRCm38)	missense	probably damaging	0.99
IGL01448:Reln	APN	5	22,040,405 (GRCm38)	missense	probably benign	0.40
IGL01612:Reln	APN	5	21,896,930 (GRCm38)	missense	probably damaging	0.99
IGL01695:Reln	APN	5	21,920,438 (GRCm38)	missense	probably damaging	1.00
IGL01718:Reln	APN	5	21,947,514 (GRCm38)	missense	possibly damaging	0.60
IGL01749:Reln	APN	5	22,344,246 (GRCm38)	nonsense	probably null
IGL01875:Reln	APN	5	21,904,717 (GRCm38)	missense	probably benign
IGL02013:Reln	APN	5	21,950,879 (GRCm38)	missense	probably damaging	1.00
IGL02031:Reln	APN	5	21,979,016 (GRCm38)	missense	probably damaging	0.99
IGL02186:Reln	APN	5	21,909,958 (GRCm38)	missense	probably damaging	1.00
IGL02228:Reln	APN	5	21,904,731 (GRCm38)	missense	probably damaging	0.99
IGL02248:Reln	APN	5	21,910,992 (GRCm38)	missense	probably damaging	1.00
IGL02336:Reln	APN	5	21,929,134 (GRCm38)	missense	probably damaging	1.00
IGL02352:Reln	APN	5	22,039,565 (GRCm38)	missense	possibly damaging	0.57
IGL02359:Reln	APN	5	22,039,565 (GRCm38)	missense	possibly damaging	0.57
IGL02376:Reln	APN	5	22,080,791 (GRCm38)	nonsense	probably null
IGL02408:Reln	APN	5	21,901,619 (GRCm38)	missense	probably benign	0.44
IGL02415:Reln	APN	5	21,971,951 (GRCm38)	missense	possibly damaging	0.91
IGL02512:Reln	APN	5	22,040,427 (GRCm38)	missense	probably benign	0.00
IGL02540:Reln	APN	5	22,034,752 (GRCm38)	missense	probably damaging	0.96
IGL02624:Reln	APN	5	22,103,357 (GRCm38)	missense	probably benign	0.09
IGL02720:Reln	APN	5	21,997,941 (GRCm38)	missense	probably damaging	0.99
IGL02894:Reln	APN	5	21,885,548 (GRCm38)	missense	possibly damaging	0.72
IGL02999:Reln	APN	5	21,995,365 (GRCm38)	missense	probably damaging	1.00
IGL03125:Reln	APN	5	21,910,844 (GRCm38)	missense	probably damaging	1.00
IGL03298:Reln	APN	5	21,910,836 (GRCm38)	missense	probably damaging	0.99
Fishing	UTSW	5	21,896,841 (GRCm38)	missense	probably damaging	1.00
P0020:Reln	UTSW	5	22,106,060 (GRCm38)	missense	possibly damaging	0.91
PIT4151001:Reln	UTSW	5	22,286,896 (GRCm38)	missense	possibly damaging	0.71
R0018:Reln	UTSW	5	21,925,371 (GRCm38)	missense	probably benign	0.01
R0105:Reln	UTSW	5	22,048,815 (GRCm38)	missense	probably damaging	0.99
R0105:Reln	UTSW	5	22,048,815 (GRCm38)	missense	probably damaging	0.99
R0127:Reln	UTSW	5	22,004,136 (GRCm38)	missense	probably damaging	1.00
R0135:Reln	UTSW	5	22,128,649 (GRCm38)	missense	probably damaging	0.99
R0144:Reln	UTSW	5	21,948,449 (GRCm38)	missense	probably damaging	0.97
R0240:Reln	UTSW	5	22,106,045 (GRCm38)	missense	probably benign	0.36
R0240:Reln	UTSW	5	22,106,045 (GRCm38)	missense	probably benign	0.36
R0242:Reln	UTSW	5	21,942,597 (GRCm38)	critical splice donor site	probably null
R0242:Reln	UTSW	5	21,942,597 (GRCm38)	critical splice donor site	probably null
R0266:Reln	UTSW	5	21,988,776 (GRCm38)	missense	probably damaging	1.00
R0269:Reln	UTSW	5	21,920,537 (GRCm38)	missense	probably damaging	1.00
R0280:Reln	UTSW	5	22,227,513 (GRCm38)	splice site	probably benign
R0333:Reln	UTSW	5	21,929,242 (GRCm38)	missense	probably damaging	0.97
R0357:Reln	UTSW	5	21,950,822 (GRCm38)	missense	probably damaging	1.00
R0359:Reln	UTSW	5	22,048,800 (GRCm38)	missense	probably damaging	0.98
R0506:Reln	UTSW	5	21,920,496 (GRCm38)	missense	probably damaging	0.97
R0534:Reln	UTSW	5	21,947,408 (GRCm38)	missense	probably damaging	0.99
R0535:Reln	UTSW	5	22,051,276 (GRCm38)	splice site	probably benign
R0541:Reln	UTSW	5	21,980,109 (GRCm38)	missense	possibly damaging	0.88
R0615:Reln	UTSW	5	22,010,150 (GRCm38)	missense	probably benign	0.36
R0617:Reln	UTSW	5	21,920,537 (GRCm38)	missense	probably damaging	1.00
R0634:Reln	UTSW	5	22,018,869 (GRCm38)	missense	probably damaging	1.00
R0653:Reln	UTSW	5	21,913,230 (GRCm38)	missense	probably benign	0.44
R0704:Reln	UTSW	5	21,896,811 (GRCm38)	missense	probably damaging	0.99
R0706:Reln	UTSW	5	21,896,811 (GRCm38)	missense	probably damaging	0.99
R0959:Reln	UTSW	5	22,227,628 (GRCm38)	missense	probably damaging	0.96
R1066:Reln	UTSW	5	22,034,664 (GRCm38)	missense	probably damaging	1.00
R1110:Reln	UTSW	5	22,034,775 (GRCm38)	missense	probably benign
R1163:Reln	UTSW	5	21,899,029 (GRCm38)	missense	probably benign	0.03
R1222:Reln	UTSW	5	21,986,955 (GRCm38)	missense	probably null	0.97
R1226:Reln	UTSW	5	21,910,866 (GRCm38)	missense	probably damaging	1.00
R1440:Reln	UTSW	5	22,128,602 (GRCm38)	splice site	probably benign
R1532:Reln	UTSW	5	22,034,744 (GRCm38)	missense	probably damaging	0.99
R1552:Reln	UTSW	5	21,960,378 (GRCm38)	missense	probably benign	0.01
R1565:Reln	UTSW	5	21,925,213 (GRCm38)	missense	probably benign	0.05
R1618:Reln	UTSW	5	22,060,368 (GRCm38)	missense	probably benign	0.01
R1636:Reln	UTSW	5	21,998,683 (GRCm38)	missense	probably damaging	0.99
R1664:Reln	UTSW	5	21,929,086 (GRCm38)	missense	probably damaging	1.00
R1716:Reln	UTSW	5	21,955,095 (GRCm38)	missense	probably damaging	0.98
R1759:Reln	UTSW	5	22,010,289 (GRCm38)	missense	probably damaging	0.99
R1835:Reln	UTSW	5	21,979,002 (GRCm38)	missense	probably damaging	1.00
R1907:Reln	UTSW	5	22,044,962 (GRCm38)	critical splice donor site	probably null
R1991:Reln	UTSW	5	21,969,360 (GRCm38)	missense	possibly damaging	0.56
R2046:Reln	UTSW	5	21,942,627 (GRCm38)	missense	probably benign	0.01
R2072:Reln	UTSW	5	21,919,177 (GRCm38)	missense	probably damaging	1.00
R2103:Reln	UTSW	5	21,969,360 (GRCm38)	missense	possibly damaging	0.56
R2119:Reln	UTSW	5	22,019,000 (GRCm38)	missense	probably damaging	1.00
R2120:Reln	UTSW	5	21,969,085 (GRCm38)	missense	probably damaging	1.00
R2216:Reln	UTSW	5	22,048,005 (GRCm38)	missense	probably benign	0.30
R2219:Reln	UTSW	5	21,972,047 (GRCm38)	missense	possibly damaging	0.88
R2228:Reln	UTSW	5	21,987,078 (GRCm38)	missense	possibly damaging	0.69
R2306:Reln	UTSW	5	21,896,786 (GRCm38)	missense	probably damaging	1.00
R2316:Reln	UTSW	5	22,154,956 (GRCm38)	missense	probably benign	0.00
R2321:Reln	UTSW	5	21,915,020 (GRCm38)	missense	probably damaging	0.99
R2512:Reln	UTSW	5	21,979,690 (GRCm38)	missense	possibly damaging	0.89
R2519:Reln	UTSW	5	22,344,369 (GRCm38)	missense	unknown
R2870:Reln	UTSW	5	22,049,791 (GRCm38)	missense	possibly damaging	0.95
R2870:Reln	UTSW	5	22,049,791 (GRCm38)	missense	possibly damaging	0.95
R2871:Reln	UTSW	5	22,049,791 (GRCm38)	missense	possibly damaging	0.95
R2871:Reln	UTSW	5	22,049,791 (GRCm38)	missense	possibly damaging	0.95
R2872:Reln	UTSW	5	22,049,791 (GRCm38)	missense	possibly damaging	0.95
R2872:Reln	UTSW	5	22,049,791 (GRCm38)	missense	possibly damaging	0.95
R3195:Reln	UTSW	5	22,040,420 (GRCm38)	missense	possibly damaging	0.72
R3545:Reln	UTSW	5	22,227,600 (GRCm38)	missense	possibly damaging	0.64
R3546:Reln	UTSW	5	22,227,600 (GRCm38)	missense	possibly damaging	0.64
R3547:Reln	UTSW	5	22,227,600 (GRCm38)	missense	possibly damaging	0.64
R3706:Reln	UTSW	5	21,995,589 (GRCm38)	splice site	probably benign
R3713:Reln	UTSW	5	21,904,734 (GRCm38)	missense	probably damaging	0.99
R3770:Reln	UTSW	5	21,948,566 (GRCm38)	missense	probably damaging	1.00
R3836:Reln	UTSW	5	21,911,014 (GRCm38)	missense	probably damaging	1.00
R3887:Reln	UTSW	5	21,910,849 (GRCm38)	missense	possibly damaging	0.92
R3972:Reln	UTSW	5	21,979,001 (GRCm38)	missense	probably damaging	0.99
R3975:Reln	UTSW	5	21,995,366 (GRCm38)	missense	possibly damaging	0.57
R4022:Reln	UTSW	5	22,227,630 (GRCm38)	missense	probably benign	0.45
R4044:Reln	UTSW	5	22,128,632 (GRCm38)	missense	possibly damaging	0.82
R4107:Reln	UTSW	5	22,034,584 (GRCm38)	missense	probably damaging	1.00
R4297:Reln	UTSW	5	21,920,487 (GRCm38)	missense	probably damaging	0.99
R4298:Reln	UTSW	5	21,920,487 (GRCm38)	missense	probably damaging	0.99
R4299:Reln	UTSW	5	21,920,487 (GRCm38)	missense	probably damaging	0.99
R4518:Reln	UTSW	5	21,901,743 (GRCm38)	missense	probably benign	0.44
R4713:Reln	UTSW	5	22,152,463 (GRCm38)	missense	probably benign	0.17
R4720:Reln	UTSW	5	22,286,896 (GRCm38)	missense	possibly damaging	0.71
R4721:Reln	UTSW	5	21,919,222 (GRCm38)	missense	probably damaging	0.99
R4771:Reln	UTSW	5	22,049,700 (GRCm38)	missense	probably damaging	1.00
R4794:Reln	UTSW	5	22,344,185 (GRCm38)	missense	probably damaging	0.98
R4840:Reln	UTSW	5	22,018,846 (GRCm38)	splice site	probably null
R4860:Reln	UTSW	5	21,901,751 (GRCm38)	missense	probably benign	0.06
R4860:Reln	UTSW	5	21,901,751 (GRCm38)	missense	probably benign	0.06
R4896:Reln	UTSW	5	21,955,238 (GRCm38)	missense	probably damaging	1.00
R4908:Reln	UTSW	5	21,979,720 (GRCm38)	missense	probably benign	0.02
R4912:Reln	UTSW	5	21,925,193 (GRCm38)	missense	probably benign	0.29
R4922:Reln	UTSW	5	21,995,587 (GRCm38)	critical splice acceptor site	probably null
R4975:Reln	UTSW	5	21,960,426 (GRCm38)	missense	probably damaging	1.00
R4976:Reln	UTSW	5	21,971,870 (GRCm38)	missense	probably benign	0.05
R5020:Reln	UTSW	5	22,034,638 (GRCm38)	missense	probably damaging	1.00
R5037:Reln	UTSW	5	21,948,512 (GRCm38)	missense	probably damaging	1.00
R5082:Reln	UTSW	5	21,896,077 (GRCm38)	missense	probably benign	0.00
R5119:Reln	UTSW	5	21,971,870 (GRCm38)	missense	probably benign	0.05
R5125:Reln	UTSW	5	21,913,241 (GRCm38)	missense	possibly damaging	0.78
R5137:Reln	UTSW	5	21,955,181 (GRCm38)	missense	probably damaging	1.00
R5152:Reln	UTSW	5	21,948,629 (GRCm38)	missense	probably damaging	1.00
R5154:Reln	UTSW	5	21,988,765 (GRCm38)	missense	probably damaging	0.99
R5259:Reln	UTSW	5	22,103,397 (GRCm38)	missense	possibly damaging	0.83
R5283:Reln	UTSW	5	22,011,163 (GRCm38)	missense	probably damaging	1.00
R5386:Reln	UTSW	5	22,039,529 (GRCm38)	missense	probably benign
R5400:Reln	UTSW	5	21,979,714 (GRCm38)	missense	probably damaging	1.00
R5478:Reln	UTSW	5	22,004,203 (GRCm38)	missense	probably benign	0.00
R5514:Reln	UTSW	5	21,971,885 (GRCm38)	missense	possibly damaging	0.93
R5529:Reln	UTSW	5	21,932,715 (GRCm38)	missense	possibly damaging	0.71
R5611:Reln	UTSW	5	22,039,665 (GRCm38)	nonsense	probably null
R5648:Reln	UTSW	5	21,998,572 (GRCm38)	missense	probably benign	0.04
R5649:Reln	UTSW	5	21,901,625 (GRCm38)	missense	probably benign	0.33
R5744:Reln	UTSW	5	22,106,083 (GRCm38)	missense	probably null	0.39
R5782:Reln	UTSW	5	22,018,056 (GRCm38)	missense	probably benign	0.01
R5815:Reln	UTSW	5	21,947,433 (GRCm38)	missense	probably damaging	0.99
R5838:Reln	UTSW	5	21,899,113 (GRCm38)	missense	probably damaging	0.97
R6162:Reln	UTSW	5	21,911,050 (GRCm38)	missense	probably damaging	1.00
R6219:Reln	UTSW	5	21,948,596 (GRCm38)	missense	probably damaging	1.00
R6259:Reln	UTSW	5	22,060,333 (GRCm38)	missense	probably damaging	0.99
R6279:Reln	UTSW	5	21,896,841 (GRCm38)	missense	probably damaging	1.00
R6299:Reln	UTSW	5	22,286,944 (GRCm38)	missense	possibly damaging	0.71
R6300:Reln	UTSW	5	21,896,841 (GRCm38)	missense	probably damaging	1.00
R6314:Reln	UTSW	5	22,152,484 (GRCm38)	nonsense	probably null
R6351:Reln	UTSW	5	21,901,663 (GRCm38)	nonsense	probably null
R6369:Reln	UTSW	5	22,051,361 (GRCm38)	missense	probably benign	0.03
R6371:Reln	UTSW	5	21,995,513 (GRCm38)	missense	probably benign
R6374:Reln	UTSW	5	22,080,714 (GRCm38)	missense	probably benign	0.06
R6425:Reln	UTSW	5	21,911,020 (GRCm38)	nonsense	probably null
R6442:Reln	UTSW	5	21,932,776 (GRCm38)	missense	probably benign
R6445:Reln	UTSW	5	21,919,214 (GRCm38)	missense	probably benign	0.05
R6554:Reln	UTSW	5	21,896,840 (GRCm38)	missense	probably damaging	1.00
R6641:Reln	UTSW	5	21,929,134 (GRCm38)	missense	probably damaging	1.00
R6768:Reln	UTSW	5	21,978,907 (GRCm38)	missense	probably damaging	0.99
R6859:Reln	UTSW	5	22,034,570 (GRCm38)	missense	probably damaging	1.00
R6896:Reln	UTSW	5	21,899,179 (GRCm38)	missense	probably benign	0.18
R6932:Reln	UTSW	5	21,985,857 (GRCm38)	missense	probably benign	0.00
R6948:Reln	UTSW	5	21,972,035 (GRCm38)	missense	probably damaging	1.00
R6959:Reln	UTSW	5	21,976,564 (GRCm38)	missense	probably damaging	1.00
R7085:Reln	UTSW	5	21,915,087 (GRCm38)	nonsense	probably null
R7091:Reln	UTSW	5	21,899,029 (GRCm38)	missense	probably null	0.08
R7135:Reln	UTSW	5	21,976,596 (GRCm38)	missense	possibly damaging	0.95
R7146:Reln	UTSW	5	22,106,097 (GRCm38)	missense	probably damaging	0.97
R7167:Reln	UTSW	5	21,942,620 (GRCm38)	missense	probably damaging	1.00
R7190:Reln	UTSW	5	22,047,947 (GRCm38)	missense	probably damaging	1.00
R7256:Reln	UTSW	5	21,978,923 (GRCm38)	missense	probably benign	0.03
R7393:Reln	UTSW	5	21,976,351 (GRCm38)	missense	probably damaging	0.99
R7399:Reln	UTSW	5	22,051,367 (GRCm38)	missense	probably damaging	0.99
R7400:Reln	UTSW	5	21,971,934 (GRCm38)	missense	probably damaging	0.99
R7426:Reln	UTSW	5	21,971,953 (GRCm38)	missense	probably damaging	1.00
R7463:Reln	UTSW	5	22,103,435 (GRCm38)	missense	probably damaging	0.98
R7470:Reln	UTSW	5	21,942,741 (GRCm38)	missense	probably damaging	0.99
R7473:Reln	UTSW	5	21,929,127 (GRCm38)	missense	probably benign	0.25
R7501:Reln	UTSW	5	22,227,638 (GRCm38)	missense	possibly damaging	0.91
R7542:Reln	UTSW	5	21,955,181 (GRCm38)	missense	probably damaging	1.00
R7544:Reln	UTSW	5	21,976,278 (GRCm38)	nonsense	probably null
R7588:Reln	UTSW	5	21,885,568 (GRCm38)	missense	probably benign	0.03
R7631:Reln	UTSW	5	21,971,935 (GRCm38)	missense	probably damaging	0.97
R7644:Reln	UTSW	5	21,978,931 (GRCm38)	missense	probably benign	0.39
R7834:Reln	UTSW	5	22,039,635 (GRCm38)	missense	possibly damaging	0.94
R7923:Reln	UTSW	5	22,134,692 (GRCm38)	missense	probably benign	0.00
R7938:Reln	UTSW	5	21,950,872 (GRCm38)	missense	probably damaging	0.97
R8006:Reln	UTSW	5	21,899,084 (GRCm38)	nonsense	probably null
R8062:Reln	UTSW	5	21,971,992 (GRCm38)	missense	probably benign	0.00
R8222:Reln	UTSW	5	21,931,477 (GRCm38)	nonsense	probably null
R8266:Reln	UTSW	5	22,018,087 (GRCm38)	missense	possibly damaging	0.62
R8267:Reln	UTSW	5	22,004,112 (GRCm38)	missense	probably damaging	1.00
R8487:Reln	UTSW	5	21,899,029 (GRCm38)	missense	probably benign	0.03
R8523:Reln	UTSW	5	22,004,231 (GRCm38)	missense	probably damaging	1.00
R8751:Reln	UTSW	5	21,942,674 (GRCm38)	missense	probably benign	0.37
R8801:Reln	UTSW	5	21,950,856 (GRCm38)	missense	possibly damaging	0.94
R8802:Reln	UTSW	5	21,925,259 (GRCm38)	missense	probably damaging	0.98
R8978:Reln	UTSW	5	21,885,514 (GRCm38)	missense	possibly damaging	0.85
R8988:Reln	UTSW	5	21,899,157 (GRCm38)	missense	probably damaging	0.97
R8995:Reln	UTSW	5	21,979,579 (GRCm38)	missense	probably benign	0.00
R9022:Reln	UTSW	5	21,976,615 (GRCm38)	missense	possibly damaging	0.66
R9042:Reln	UTSW	5	22,048,038 (GRCm38)	missense	probably damaging	1.00
R9069:Reln	UTSW	5	22,011,061 (GRCm38)	missense	probably damaging	1.00
R9089:Reln	UTSW	5	21,925,200 (GRCm38)	missense	probably benign	0.01
R9126:Reln	UTSW	5	21,955,196 (GRCm38)	missense	probably damaging	1.00
R9172:Reln	UTSW	5	21,950,817 (GRCm38)	critical splice donor site	probably null
R9182:Reln	UTSW	5	21,901,619 (GRCm38)	missense	probably benign	0.44
R9196:Reln	UTSW	5	22,152,473 (GRCm38)	missense	probably damaging	1.00
R9211:Reln	UTSW	5	22,344,202 (GRCm38)	nonsense	probably null
R9241:Reln	UTSW	5	21,969,069 (GRCm38)	missense	probably damaging	0.99
R9244:Reln	UTSW	5	21,915,153 (GRCm38)	missense	probably damaging	0.99
R9281:Reln	UTSW	5	21,948,547 (GRCm38)	missense	probably damaging	1.00
R9295:Reln	UTSW	5	22,004,211 (GRCm38)	missense	possibly damaging	0.95
R9303:Reln	UTSW	5	21,988,707 (GRCm38)	missense	possibly damaging	0.95
R9303:Reln	UTSW	5	22,080,691 (GRCm38)	missense	probably benign	0.01
R9309:Reln	UTSW	5	21,971,868 (GRCm38)	missense	probably benign	0.37
R9338:Reln	UTSW	5	21,997,939 (GRCm38)	missense	probably damaging	0.98
R9381:Reln	UTSW	5	22,344,204 (GRCm38)	missense	possibly damaging	0.93
R9430:Reln	UTSW	5	21,915,107 (GRCm38)	missense	probably damaging	1.00
R9509:Reln	UTSW	5	22,344,200 (GRCm38)	missense	possibly damaging	0.93
R9515:Reln	UTSW	5	21,920,510 (GRCm38)	missense	possibly damaging	0.46
R9717:Reln	UTSW	5	21,931,429 (GRCm38)	missense	probably benign	0.26
R9745:Reln	UTSW	5	21,947,527 (GRCm38)	missense	probably damaging	1.00
R9778:Reln	UTSW	5	21,950,945 (GRCm38)	missense	probably damaging	1.00
Z1176:Reln	UTSW	5	21,979,024 (GRCm38)	missense	probably damaging	1.00
Z1177:Reln	UTSW	5	22,004,082 (GRCm38)	missense	probably damaging	0.96
Z1177:Reln	UTSW	5	21,969,241 (GRCm38)	missense	probably damaging	0.96
Z1177:Reln	UTSW	5	22,227,636 (GRCm38)	missense	probably damaging	1.00
Z1177:Reln	UTSW	5	22,154,959 (GRCm38)	missense	probably benign	0.05

Predicted Primers

PCR Primer
(F):5'- TGAGTTTACCTACCAGCACGG -3'
(R):5'- GCTCGTCATATGTAACCGTCATTATG -3'

Sequencing Primer
(F):5'- CAACAGTAGTTATCTCACCACTATGG -3'
(R):5'- GTCTAACTATGTAACTATCACTCCGC -3'

Posted On

2015-09-25