Incidental Mutation 'R4615:Ran'
ID 345017
Institutional Source Beutler Lab
Gene Symbol Ran
Ensembl Gene ENSMUSG00000029430
Gene Name RAN, member RAS oncogene family
Synonyms
MMRRC Submission 041826-MU
Accession Numbers
Essential gene? Not available question?
Stock # R4615 (G1)
Quality Score 225
Status Not validated
Chromosome 5
Chromosomal Location 129097220-129101386 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 129099162 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 115 (I115V)
Ref Sequence ENSEMBL: ENSMUSP00000106975 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031383] [ENSMUST00000111343]
AlphaFold P62827
Predicted Effect probably benign
Transcript: ENSMUST00000031383
AA Change: I115V

PolyPhen 2 Score 0.066 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000031383
Gene: ENSMUSG00000029430
AA Change: I115V

DomainStartEndE-ValueType
RAN 16 216 2.2e-171 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111343
AA Change: I115V

PolyPhen 2 Score 0.066 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000106975
Gene: ENSMUSG00000029430
AA Change: I115V

DomainStartEndE-ValueType
RAN 16 216 2.2e-171 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134632
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] RAN (ras-related nuclear protein) is a small GTP binding protein belonging to the RAS superfamily that is essential for the translocation of RNA and proteins through the nuclear pore complex. The RAN protein is also involved in control of DNA synthesis and cell cycle progression. Nuclear localization of RAN requires the presence of regulator of chromosome condensation 1 (RCC1). Mutations in RAN disrupt DNA synthesis. Because of its many functions, it is likely that RAN interacts with several other proteins. RAN regulates formation and organization of the microtubule network independently of its role in the nucleus-cytosol exchange of macromolecules. RAN could be a key signaling molecule regulating microtubule polymerization during mitosis. RCC1 generates a high local concentration of RAN-GTP around chromatin which, in turn, induces the local nucleation of microtubules. RAN is an androgen receptor (AR) coactivator that binds differentially with different lengths of polyglutamine within the androgen receptor. Polyglutamine repeat expansion in the AR is linked to Kennedy's disease (X-linked spinal and bulbar muscular atrophy). RAN coactivation of the AR diminishes with polyglutamine expansion within the AR, and this weak coactivation may lead to partial androgen insensitivity during the development of Kennedy's disease. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 T C 1: 71,369,493 (GRCm39) I363V probably benign Het
Abcc9 C G 6: 142,634,833 (GRCm39) A144P possibly damaging Het
Adgrv1 C T 13: 81,642,688 (GRCm39) probably null Het
Adprhl1 A G 8: 13,292,250 (GRCm39) probably null Het
Angptl3 A T 4: 98,919,598 (GRCm39) E119D probably benign Het
Atp8b1 T C 18: 64,686,170 (GRCm39) N671S probably null Het
C9 A G 15: 6,520,944 (GRCm39) D51G probably damaging Het
Carmil2 A G 8: 106,421,706 (GRCm39) D1019G possibly damaging Het
Cdh8 A T 8: 100,006,254 (GRCm39) I111K probably damaging Het
Cep120 T C 18: 53,847,913 (GRCm39) R649G probably damaging Het
Clptm1l A T 13: 73,755,857 (GRCm39) K158* probably null Het
Cmtm1 CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT 8: 105,036,102 (GRCm39) probably benign Het
Cnga1 A C 5: 72,762,117 (GRCm39) L466V probably damaging Het
Cpsf1 T C 15: 76,481,137 (GRCm39) T1240A possibly damaging Het
Cubn A G 2: 13,433,560 (GRCm39) S1117P probably damaging Het
Cyp2b9 T A 7: 25,900,550 (GRCm39) L396Q probably damaging Het
Cyp8b1 A T 9: 121,745,164 (GRCm39) L56* probably null Het
Dcbld2 A G 16: 58,276,457 (GRCm39) T458A probably benign Het
Dio2 G T 12: 90,696,595 (GRCm39) P131Q probably damaging Het
Dlg5 T C 14: 24,208,236 (GRCm39) Y990C probably damaging Het
Dsc3 T C 18: 20,104,545 (GRCm39) D594G possibly damaging Het
Dsp A G 13: 38,375,608 (GRCm39) E1131G probably damaging Het
Fdx1 A T 9: 51,859,945 (GRCm39) Y21* probably null Het
Gal3st4 A G 5: 138,264,525 (GRCm39) V158A probably damaging Het
Gm10269 T A 18: 20,815,820 (GRCm39) E67D probably benign Het
Gm5773 A G 3: 93,681,339 (GRCm39) H337R probably benign Het
Gng2 C T 14: 19,941,395 (GRCm39) V16I possibly damaging Het
Gpr20 T C 15: 73,567,585 (GRCm39) N268S probably benign Het
Ighv1-82 T C 12: 115,916,280 (GRCm39) T77A probably benign Het
Itprid2 A G 2: 79,492,726 (GRCm39) E1091G probably damaging Het
Lama2 C A 10: 26,857,520 (GRCm39) V3110F probably damaging Het
Mplkipl1 C T 19: 61,164,364 (GRCm39) G24R unknown Het
Mtmr4 T C 11: 87,501,761 (GRCm39) L548S probably damaging Het
Ncapg A T 5: 45,844,741 (GRCm39) M579L probably benign Het
Oog3 A T 4: 143,884,899 (GRCm39) Y346N probably benign Het
Or10ak14 T C 4: 118,611,334 (GRCm39) T134A probably benign Het
Or14c39 T C 7: 86,343,936 (GRCm39) S91P probably damaging Het
Orm2 A G 4: 63,281,536 (GRCm39) D89G probably damaging Het
Pcdhb4 T A 18: 37,441,553 (GRCm39) S288T probably benign Het
Pcsk2 G T 2: 143,637,889 (GRCm39) C375F probably damaging Het
Pdcd10 T C 3: 75,428,398 (GRCm39) I138M probably damaging Het
Pde8a T C 7: 80,970,485 (GRCm39) W536R probably damaging Het
Phkg2 C T 7: 127,176,792 (GRCm39) R61W probably damaging Het
Plcl1 A T 1: 55,737,293 (GRCm39) N878I probably benign Het
Prkdc A T 16: 15,480,938 (GRCm39) D353V probably damaging Het
Psme4 C T 11: 30,784,287 (GRCm39) T954I probably benign Het
Reln A G 5: 22,177,870 (GRCm39) L1867P possibly damaging Het
S100a1 A G 3: 90,418,562 (GRCm39) V84A possibly damaging Het
Sall2 G A 14: 52,550,207 (GRCm39) P994L probably benign Het
Shtn1 A T 19: 59,010,648 (GRCm39) I273N probably benign Het
Slc17a9 T C 2: 180,373,699 (GRCm39) I40T probably benign Het
Slc29a2 T C 19: 5,079,292 (GRCm39) V305A probably damaging Het
Taar2 T A 10: 23,817,263 (GRCm39) F268I probably benign Het
Taf3 G A 2: 9,956,901 (GRCm39) T422I probably damaging Het
Tgs1 T C 4: 3,585,156 (GRCm39) F99L probably damaging Het
Tox2 T C 2: 163,162,567 (GRCm39) L479P probably damaging Het
Ttn A G 2: 76,597,219 (GRCm39) I19898T probably damaging Het
Ulk1 G T 5: 110,936,912 (GRCm39) T3N probably damaging Het
Vars1 A T 17: 35,232,857 (GRCm39) K900N probably damaging Het
Vmn2r15 A G 5: 109,441,348 (GRCm39) V170A possibly damaging Het
Vmn2r53 A T 7: 12,316,229 (GRCm39) L530Q probably damaging Het
Zar1l G T 5: 150,441,528 (GRCm39) Q33K probably benign Het
Zdhhc16 T C 19: 41,932,122 (GRCm39) V358A possibly damaging Het
Other mutations in Ran
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02238:Ran APN 5 129,099,246 (GRCm39) missense possibly damaging 0.46
R7774:Ran UTSW 5 129,099,874 (GRCm39) missense probably benign 0.00
Z1176:Ran UTSW 5 129,099,166 (GRCm39) missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- ATTGGAGTCAGTGTGCCATG -3'
(R):5'- TCTCCATTCCAGGACATTCTAAAC -3'

Sequencing Primer
(F):5'- ACCATCTAACTTTTTAGTGGGGGAC -3'
(R):5'- TTCCAGGACATTCTAAACAAAGAC -3'
Posted On 2015-09-25