Incidental Mutation 'R4615:Pde8a'
ID345024
Institutional Source Beutler Lab
Gene Symbol Pde8a
Ensembl Gene ENSMUSG00000025584
Gene Namephosphodiesterase 8A
SynonymsPde8
MMRRC Submission 041826-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4615 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location81213596-81334533 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 81320737 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 536 (W536R)
Ref Sequence ENSEMBL: ENSMUSP00000026672 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026672]
Predicted Effect probably damaging
Transcript: ENSMUST00000026672
AA Change: W536R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000026672
Gene: ENSMUSG00000025584
AA Change: W536R

DomainStartEndE-ValueType
low complexity region 19 32 N/A INTRINSIC
Blast:REC 79 194 2e-48 BLAST
PAS 211 277 2.18e-2 SMART
Blast:HDc 403 451 4e-11 BLAST
HDc 548 734 5.78e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130494
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the cyclic nucleotide phosphodiesterase (PDE) family, and PDE8 subfamily. This PDE hydrolyzes the second messenger, cAMP, which is a regulator and mediator of a number of cellular responses to extracellular signals. Thus, by regulating the cellular concentration of cAMP, this protein plays a key role in many important physiological processes. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Jul 2011]
PHENOTYPE: Targeted disruption of this gene results in a 4-fold increase in basal release of testosterone in isolated Leydig cells as well as a significant increase in the sensitivity to luteinizing hormone, measured as testosterone released into the media. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 T C 1: 71,330,334 I363V probably benign Het
Abcc9 C G 6: 142,689,107 A144P possibly damaging Het
Adgrv1 C T 13: 81,494,569 probably null Het
Adprhl1 A G 8: 13,242,250 probably null Het
Angptl3 A T 4: 99,031,361 E119D probably benign Het
Atp8b1 T C 18: 64,553,099 N671S probably null Het
C9 A G 15: 6,491,463 D51G probably damaging Het
Carmil2 A G 8: 105,695,074 D1019G possibly damaging Het
Cdh8 A T 8: 99,279,622 I111K probably damaging Het
Cep120 T C 18: 53,714,841 R649G probably damaging Het
Clptm1l A T 13: 73,607,738 K158* probably null Het
Cmtm1 CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT 8: 104,309,470 probably benign Het
Cnga1 A C 5: 72,604,774 L466V probably damaging Het
Cpsf1 T C 15: 76,596,937 T1240A possibly damaging Het
Cubn A G 2: 13,428,749 S1117P probably damaging Het
Cyp2b9 T A 7: 26,201,125 L396Q probably damaging Het
Cyp8b1 A T 9: 121,916,098 L56* probably null Het
Dcbld2 A G 16: 58,456,094 T458A probably benign Het
Dio2 G T 12: 90,729,821 P131Q probably damaging Het
Dlg5 T C 14: 24,158,168 Y990C probably damaging Het
Dsc3 T C 18: 19,971,488 D594G possibly damaging Het
Dsp A G 13: 38,191,632 E1131G probably damaging Het
Fdx1 A T 9: 51,948,645 Y21* probably null Het
Gal3st4 A G 5: 138,266,263 V158A probably damaging Het
Gm10269 T A 18: 20,682,763 E67D probably benign Het
Gm5773 A G 3: 93,774,032 H337R probably benign Het
Gm7102 C T 19: 61,175,926 G24R unknown Het
Gng2 C T 14: 19,891,327 V16I possibly damaging Het
Gpr20 T C 15: 73,695,736 N268S probably benign Het
Ighv1-82 T C 12: 115,952,660 T77A probably benign Het
Lama2 C A 10: 26,981,524 V3110F probably damaging Het
Mtmr4 T C 11: 87,610,935 L548S probably damaging Het
Ncapg A T 5: 45,687,399 M579L probably benign Het
Olfr1338 T C 4: 118,754,137 T134A probably benign Het
Olfr292 T C 7: 86,694,728 S91P probably damaging Het
Oog3 A T 4: 144,158,329 Y346N probably benign Het
Orm2 A G 4: 63,363,299 D89G probably damaging Het
Pcdhb4 T A 18: 37,308,500 S288T probably benign Het
Pcsk2 G T 2: 143,795,969 C375F probably damaging Het
Pdcd10 T C 3: 75,521,091 I138M probably damaging Het
Phkg2 C T 7: 127,577,620 R61W probably damaging Het
Plcl1 A T 1: 55,698,134 N878I probably benign Het
Prkdc A T 16: 15,663,074 D353V probably damaging Het
Psme4 C T 11: 30,834,287 T954I probably benign Het
Ran A G 5: 129,022,098 I115V probably benign Het
Reln A G 5: 21,972,872 L1867P possibly damaging Het
S100a1 A G 3: 90,511,255 V84A possibly damaging Het
Sall2 G A 14: 52,312,750 P994L probably benign Het
Shtn1 A T 19: 59,022,216 I273N probably benign Het
Slc17a9 T C 2: 180,731,906 I40T probably benign Het
Slc29a2 T C 19: 5,029,264 V305A probably damaging Het
Ssfa2 A G 2: 79,662,382 E1091G probably damaging Het
Taar2 T A 10: 23,941,365 F268I probably benign Het
Taf3 G A 2: 9,952,090 T422I probably damaging Het
Tgs1 T C 4: 3,585,156 F99L probably damaging Het
Tox2 T C 2: 163,320,647 L479P probably damaging Het
Ttn A G 2: 76,766,875 I19898T probably damaging Het
Ulk1 G T 5: 110,789,046 T3N probably damaging Het
Vars A T 17: 35,013,881 K900N probably damaging Het
Vmn2r15 A G 5: 109,293,482 V170A possibly damaging Het
Vmn2r53 A T 7: 12,582,302 L530Q probably damaging Het
Zar1l G T 5: 150,518,063 Q33K probably benign Het
Zdhhc16 T C 19: 41,943,683 V358A possibly damaging Het
Other mutations in Pde8a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00694:Pde8a APN 7 81306708 missense possibly damaging 0.62
IGL00808:Pde8a APN 7 81283014 critical splice donor site probably null
IGL01134:Pde8a APN 7 81319078 missense possibly damaging 0.86
IGL01443:Pde8a APN 7 81324181 missense probably damaging 1.00
IGL02044:Pde8a APN 7 81317449 critical splice donor site probably null
IGL02269:Pde8a APN 7 81308802 splice site probably benign
IGL02528:Pde8a APN 7 81293189 splice site probably benign
IGL02738:Pde8a APN 7 81326342 missense probably damaging 1.00
IGL02937:Pde8a APN 7 81295771 splice site probably benign
IGL03072:Pde8a APN 7 81308809 missense probably damaging 1.00
cast_iron UTSW 7 81282807 intron probably null
K7894:Pde8a UTSW 7 81306765 missense probably damaging 1.00
R0069:Pde8a UTSW 7 81319123 splice site probably benign
R0069:Pde8a UTSW 7 81319123 splice site probably benign
R0547:Pde8a UTSW 7 81324130 missense probably benign 0.00
R0552:Pde8a UTSW 7 81317347 missense probably benign 0.12
R1342:Pde8a UTSW 7 81302294 critical splice donor site probably null
R1469:Pde8a UTSW 7 81302271 missense probably damaging 1.00
R1469:Pde8a UTSW 7 81302271 missense probably damaging 1.00
R1502:Pde8a UTSW 7 81292259 missense probably damaging 1.00
R1568:Pde8a UTSW 7 81292263 missense probably damaging 1.00
R1768:Pde8a UTSW 7 81300723 splice site probably null
R2076:Pde8a UTSW 7 81308945 missense probably benign 0.11
R2165:Pde8a UTSW 7 81295768 critical splice donor site probably null
R2385:Pde8a UTSW 7 81282992 missense probably benign 0.45
R2518:Pde8a UTSW 7 81317422 missense probably benign 0.00
R4001:Pde8a UTSW 7 81317356 missense probably damaging 1.00
R4114:Pde8a UTSW 7 81282807 intron probably null
R4115:Pde8a UTSW 7 81282807 intron probably null
R4159:Pde8a UTSW 7 81320659 missense probably benign 0.13
R4299:Pde8a UTSW 7 81328035 missense probably benign
R4544:Pde8a UTSW 7 81328099 missense probably damaging 0.98
R4545:Pde8a UTSW 7 81328099 missense probably damaging 0.98
R4561:Pde8a UTSW 7 81308820 nonsense probably null
R4562:Pde8a UTSW 7 81308820 nonsense probably null
R4563:Pde8a UTSW 7 81308820 nonsense probably null
R4808:Pde8a UTSW 7 81282931 missense probably benign
R5396:Pde8a UTSW 7 81333422 missense probably damaging 1.00
R5840:Pde8a UTSW 7 81213965 missense probably benign
R5892:Pde8a UTSW 7 81295691 missense probably damaging 0.99
R6621:Pde8a UTSW 7 81293130 critical splice acceptor site probably null
R7067:Pde8a UTSW 7 81317326 missense probably benign 0.41
R7163:Pde8a UTSW 7 81306708 missense possibly damaging 0.62
R7483:Pde8a UTSW 7 81282833 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- GATCAGTTGCCCTGGTACTCTG -3'
(R):5'- ACTCTGGTTATTACGGTGCAG -3'

Sequencing Primer
(F):5'- CTCTGCACTGTGGCTTGAATGTAC -3'
(R):5'- ATTACGGTGCAGTGAGGGC -3'
Posted On2015-09-25