Incidental Mutation 'R4615:Phkg2'
ID345026
Institutional Source Beutler Lab
Gene Symbol Phkg2
Ensembl Gene ENSMUSG00000030815
Gene Namephosphorylase kinase, gamma 2 (testis)
Synonyms
MMRRC Submission 041826-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.369) question?
Stock #R4615 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location127573340-127583307 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 127577620 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Tryptophan at position 61 (R61W)
Ref Sequence ENSEMBL: ENSMUSP00000145927 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033086] [ENSMUST00000072155] [ENSMUST00000121004] [ENSMUST00000146383] [ENSMUST00000154891] [ENSMUST00000205633]
Predicted Effect probably damaging
Transcript: ENSMUST00000033086
AA Change: R61W

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000033086
Gene: ENSMUSG00000030815
AA Change: R61W

DomainStartEndE-ValueType
S_TKc 24 291 6.4e-104 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000072155
SMART Domains Protein: ENSMUSP00000072019
Gene: ENSMUSG00000057176

DomainStartEndE-ValueType
Pfam:CLAMP 130 228 3.1e-37 PFAM
low complexity region 243 274 N/A INTRINSIC
coiled coil region 285 319 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000121004
AA Change: R61W

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000113533
Gene: ENSMUSG00000030815
AA Change: R61W

DomainStartEndE-ValueType
S_TKc 24 291 6.4e-104 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129457
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133621
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138158
Predicted Effect probably damaging
Transcript: ENSMUST00000146383
AA Change: R61W

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000115593
Gene: ENSMUSG00000030815
AA Change: R61W

DomainStartEndE-ValueType
Pfam:Pkinase 24 85 8.6e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149853
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151908
Predicted Effect unknown
Transcript: ENSMUST00000154891
AA Change: R61W
SMART Domains Protein: ENSMUSP00000116860
Gene: ENSMUSG00000030815
AA Change: R61W

DomainStartEndE-ValueType
Pfam:Pkinase 24 78 4.5e-6 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190938
Predicted Effect probably damaging
Transcript: ENSMUST00000205633
AA Change: R61W

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably benign
Transcript: ENSMUST00000206818
Meta Mutation Damage Score 0.2820 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Phosphorylase kinase is a polymer of 16 subunits, four each of alpha, beta, gamma and delta. The alpha subunit includes the skeletal muscle and hepatic isoforms, encoded by two different genes. The beta subunit is the same in both the muscle and hepatic isoforms, and encoded by one gene. The gamma subunit also includes the skeletal muscle and hepatic isoforms, and the hepatic isoform is encoded by this gene. The delta subunit is a calmodulin and can be encoded by three different genes. The gamma subunits contain the active site of the enzyme, whereas the alpha and beta subunits have regulatory functions controlled by phosphorylation. The delta subunit mediates the dependence of the enzyme on calcium concentration. Mutations in this gene cause glycogen storage disease type 9C, also known as autosomal liver glycogenosis. Alternatively spliced transcript variants encoding different isoforms have been identified in this gene.[provided by RefSeq, Feb 2010]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 T C 1: 71,330,334 I363V probably benign Het
Abcc9 C G 6: 142,689,107 A144P possibly damaging Het
Adgrv1 C T 13: 81,494,569 probably null Het
Adprhl1 A G 8: 13,242,250 probably null Het
Angptl3 A T 4: 99,031,361 E119D probably benign Het
Atp8b1 T C 18: 64,553,099 N671S probably null Het
C9 A G 15: 6,491,463 D51G probably damaging Het
Carmil2 A G 8: 105,695,074 D1019G possibly damaging Het
Cdh8 A T 8: 99,279,622 I111K probably damaging Het
Cep120 T C 18: 53,714,841 R649G probably damaging Het
Clptm1l A T 13: 73,607,738 K158* probably null Het
Cmtm1 CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT 8: 104,309,470 probably benign Het
Cnga1 A C 5: 72,604,774 L466V probably damaging Het
Cpsf1 T C 15: 76,596,937 T1240A possibly damaging Het
Cubn A G 2: 13,428,749 S1117P probably damaging Het
Cyp2b9 T A 7: 26,201,125 L396Q probably damaging Het
Cyp8b1 A T 9: 121,916,098 L56* probably null Het
Dcbld2 A G 16: 58,456,094 T458A probably benign Het
Dio2 G T 12: 90,729,821 P131Q probably damaging Het
Dlg5 T C 14: 24,158,168 Y990C probably damaging Het
Dsc3 T C 18: 19,971,488 D594G possibly damaging Het
Dsp A G 13: 38,191,632 E1131G probably damaging Het
Fdx1 A T 9: 51,948,645 Y21* probably null Het
Gal3st4 A G 5: 138,266,263 V158A probably damaging Het
Gm10269 T A 18: 20,682,763 E67D probably benign Het
Gm5773 A G 3: 93,774,032 H337R probably benign Het
Gm7102 C T 19: 61,175,926 G24R unknown Het
Gng2 C T 14: 19,891,327 V16I possibly damaging Het
Gpr20 T C 15: 73,695,736 N268S probably benign Het
Ighv1-82 T C 12: 115,952,660 T77A probably benign Het
Lama2 C A 10: 26,981,524 V3110F probably damaging Het
Mtmr4 T C 11: 87,610,935 L548S probably damaging Het
Ncapg A T 5: 45,687,399 M579L probably benign Het
Olfr1338 T C 4: 118,754,137 T134A probably benign Het
Olfr292 T C 7: 86,694,728 S91P probably damaging Het
Oog3 A T 4: 144,158,329 Y346N probably benign Het
Orm2 A G 4: 63,363,299 D89G probably damaging Het
Pcdhb4 T A 18: 37,308,500 S288T probably benign Het
Pcsk2 G T 2: 143,795,969 C375F probably damaging Het
Pdcd10 T C 3: 75,521,091 I138M probably damaging Het
Pde8a T C 7: 81,320,737 W536R probably damaging Het
Plcl1 A T 1: 55,698,134 N878I probably benign Het
Prkdc A T 16: 15,663,074 D353V probably damaging Het
Psme4 C T 11: 30,834,287 T954I probably benign Het
Ran A G 5: 129,022,098 I115V probably benign Het
Reln A G 5: 21,972,872 L1867P possibly damaging Het
S100a1 A G 3: 90,511,255 V84A possibly damaging Het
Sall2 G A 14: 52,312,750 P994L probably benign Het
Shtn1 A T 19: 59,022,216 I273N probably benign Het
Slc17a9 T C 2: 180,731,906 I40T probably benign Het
Slc29a2 T C 19: 5,029,264 V305A probably damaging Het
Ssfa2 A G 2: 79,662,382 E1091G probably damaging Het
Taar2 T A 10: 23,941,365 F268I probably benign Het
Taf3 G A 2: 9,952,090 T422I probably damaging Het
Tgs1 T C 4: 3,585,156 F99L probably damaging Het
Tox2 T C 2: 163,320,647 L479P probably damaging Het
Ttn A G 2: 76,766,875 I19898T probably damaging Het
Ulk1 G T 5: 110,789,046 T3N probably damaging Het
Vars A T 17: 35,013,881 K900N probably damaging Het
Vmn2r15 A G 5: 109,293,482 V170A possibly damaging Het
Vmn2r53 A T 7: 12,582,302 L530Q probably damaging Het
Zar1l G T 5: 150,518,063 Q33K probably benign Het
Zdhhc16 T C 19: 41,943,683 V358A possibly damaging Het
Other mutations in Phkg2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01953:Phkg2 APN 7 127582340 missense probably damaging 1.00
IGL02259:Phkg2 APN 7 127582286 intron probably benign
IGL02699:Phkg2 APN 7 127582550 missense probably benign
IGL03039:Phkg2 APN 7 127579694 nonsense probably null
R0326:Phkg2 UTSW 7 127573903 missense probably damaging 1.00
R2141:Phkg2 UTSW 7 127582214 critical splice donor site probably null
R2142:Phkg2 UTSW 7 127582214 critical splice donor site probably null
R2763:Phkg2 UTSW 7 127579833 missense probably benign 0.00
R4614:Phkg2 UTSW 7 127577620 missense probably damaging 1.00
R4616:Phkg2 UTSW 7 127577620 missense probably damaging 1.00
R4666:Phkg2 UTSW 7 127577984 missense possibly damaging 0.93
R4981:Phkg2 UTSW 7 127582379 missense probably damaging 1.00
R4993:Phkg2 UTSW 7 127573941 missense probably damaging 1.00
R5287:Phkg2 UTSW 7 127582757 frame shift probably null
R5416:Phkg2 UTSW 7 127582935 missense possibly damaging 0.46
R7276:Phkg2 UTSW 7 127582386 missense possibly damaging 0.80
R7655:Phkg2 UTSW 7 127582902 missense probably damaging 0.99
R7656:Phkg2 UTSW 7 127582902 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGAAGCTCGATGTGGTGGTG -3'
(R):5'- GCAATTCTAGGGTGTGGGTCA -3'

Sequencing Primer
(F):5'- CACCCAGTCTTACAGGATGTGATG -3'
(R):5'- GTGGGTCATGAATAGGGCC -3'
Posted On2015-09-25