Mutagenetix > Incidental Mutation

Incidental Mutation 'R4615:Psme4'

345035

Institutional Source

Beutler Lab

Gene Symbol

Psme4

Ensembl Gene

ENSMUSG00000040850

Gene Name

proteasome (prosome, macropain) activator subunit 4

Synonyms

MMRRC Submission

041826-MU

Accession Numbers

Genbank: NM_134013

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4615 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

30771726-30880361 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 30834287 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Isoleucine at position 954 (T954I)

Ref Sequence

ENSEMBL: ENSMUSP00000045460 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000041231]

AlphaFold

Q5SSW2

Predicted Effect

probably benign
Transcript: ENSMUST00000041231
AA Change: T954I

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)

SMART Domains

Protein: ENSMUSP00000045460
Gene: ENSMUSG00000040850
AA Change: T954I

Domain	Start	End	E-Value	Type
low complexity region	2	19	N/A	INTRINSIC
low complexity region	122	133	N/A	INTRINSIC
Pfam:BLM10_mid	330	828	8.8e-119	PFAM
SCOP:d1b3ua_	1183	1716	3e-14	SMART
Pfam:DUF3437	1756	1843	5.3e-39	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000142217

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000150219

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 95.1%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice homozygous for a knock-out allele show normal repair of DNA double-strand breaks but exhibit significantly reduced male fertility due to defects in spermatogenesis observed in both meiotic spermatocytes and postmeiotic haploid spermatids. [provided by MGI curators]

Allele List at MGI

All alleles(25) : Targeted, knock-out(1) Gene trapped(24)

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca12	T	C	1: 71,330,334	I363V	probably benign	Het
Abcc9	C	G	6: 142,689,107	A144P	possibly damaging	Het
Adgrv1	C	T	13: 81,494,569		probably null	Het
Adprhl1	A	G	8: 13,242,250		probably null	Het
Angptl3	A	T	4: 99,031,361	E119D	probably benign	Het
Atp8b1	T	C	18: 64,553,099	N671S	probably null	Het
C9	A	G	15: 6,491,463	D51G	probably damaging	Het
Carmil2	A	G	8: 105,695,074	D1019G	possibly damaging	Het
Cdh8	A	T	8: 99,279,622	I111K	probably damaging	Het
Cep120	T	C	18: 53,714,841	R649G	probably damaging	Het
Clptm1l	A	T	13: 73,607,738	K158*	probably null	Het
Cmtm1	CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT	CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT	8: 104,309,470		probably benign	Het
Cnga1	A	C	5: 72,604,774	L466V	probably damaging	Het
Cpsf1	T	C	15: 76,596,937	T1240A	possibly damaging	Het
Cubn	A	G	2: 13,428,749	S1117P	probably damaging	Het
Cyp2b9	T	A	7: 26,201,125	L396Q	probably damaging	Het
Cyp8b1	A	T	9: 121,916,098	L56*	probably null	Het
Dcbld2	A	G	16: 58,456,094	T458A	probably benign	Het
Dio2	G	T	12: 90,729,821	P131Q	probably damaging	Het
Dlg5	T	C	14: 24,158,168	Y990C	probably damaging	Het
Dsc3	T	C	18: 19,971,488	D594G	possibly damaging	Het
Dsp	A	G	13: 38,191,632	E1131G	probably damaging	Het
Fdx1	A	T	9: 51,948,645	Y21*	probably null	Het
Gal3st4	A	G	5: 138,266,263	V158A	probably damaging	Het
Gm10269	T	A	18: 20,682,763	E67D	probably benign	Het
Gm5773	A	G	3: 93,774,032	H337R	probably benign	Het
Gm7102	C	T	19: 61,175,926	G24R	unknown	Het
Gng2	C	T	14: 19,891,327	V16I	possibly damaging	Het
Gpr20	T	C	15: 73,695,736	N268S	probably benign	Het
Ighv1-82	T	C	12: 115,952,660	T77A	probably benign	Het
Lama2	C	A	10: 26,981,524	V3110F	probably damaging	Het
Mtmr4	T	C	11: 87,610,935	L548S	probably damaging	Het
Ncapg	A	T	5: 45,687,399	M579L	probably benign	Het
Olfr1338	T	C	4: 118,754,137	T134A	probably benign	Het
Olfr292	T	C	7: 86,694,728	S91P	probably damaging	Het
Oog3	A	T	4: 144,158,329	Y346N	probably benign	Het
Orm2	A	G	4: 63,363,299	D89G	probably damaging	Het
Pcdhb4	T	A	18: 37,308,500	S288T	probably benign	Het
Pcsk2	G	T	2: 143,795,969	C375F	probably damaging	Het
Pdcd10	T	C	3: 75,521,091	I138M	probably damaging	Het
Pde8a	T	C	7: 81,320,737	W536R	probably damaging	Het
Phkg2	C	T	7: 127,577,620	R61W	probably damaging	Het
Plcl1	A	T	1: 55,698,134	N878I	probably benign	Het
Prkdc	A	T	16: 15,663,074	D353V	probably damaging	Het
Ran	A	G	5: 129,022,098	I115V	probably benign	Het
Reln	A	G	5: 21,972,872	L1867P	possibly damaging	Het
S100a1	A	G	3: 90,511,255	V84A	possibly damaging	Het
Sall2	G	A	14: 52,312,750	P994L	probably benign	Het
Shtn1	A	T	19: 59,022,216	I273N	probably benign	Het
Slc17a9	T	C	2: 180,731,906	I40T	probably benign	Het
Slc29a2	T	C	19: 5,029,264	V305A	probably damaging	Het
Ssfa2	A	G	2: 79,662,382	E1091G	probably damaging	Het
Taar2	T	A	10: 23,941,365	F268I	probably benign	Het
Taf3	G	A	2: 9,952,090	T422I	probably damaging	Het
Tgs1	T	C	4: 3,585,156	F99L	probably damaging	Het
Tox2	T	C	2: 163,320,647	L479P	probably damaging	Het
Ttn	A	G	2: 76,766,875	I19898T	probably damaging	Het
Ulk1	G	T	5: 110,789,046	T3N	probably damaging	Het
Vars	A	T	17: 35,013,881	K900N	probably damaging	Het
Vmn2r15	A	G	5: 109,293,482	V170A	possibly damaging	Het
Vmn2r53	A	T	7: 12,582,302	L530Q	probably damaging	Het
Zar1l	G	T	5: 150,518,063	Q33K	probably benign	Het
Zdhhc16	T	C	19: 41,943,683	V358A	possibly damaging	Het

Other mutations in Psme4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00228:Psme4	APN	11	30815710	critical splice donor site	probably null
IGL00401:Psme4	APN	11	30821079	splice site	probably benign
IGL00475:Psme4	APN	11	30845252	missense	probably benign	0.14
IGL00576:Psme4	APN	11	30823145	missense	possibly damaging	0.50
IGL00817:Psme4	APN	11	30820129	missense	probably benign	0.01
IGL01525:Psme4	APN	11	30809936	splice site	probably benign
IGL01862:Psme4	APN	11	30812038	nonsense	probably null
IGL02310:Psme4	APN	11	30837484	missense	probably benign	0.06
IGL02477:Psme4	APN	11	30842083	missense	probably damaging	0.99
IGL02545:Psme4	APN	11	30841586	missense	possibly damaging	0.81
IGL02608:Psme4	APN	11	30820944	missense	probably benign	0.34
IGL02621:Psme4	APN	11	30848131	missense	probably benign
IGL02822:Psme4	APN	11	30848204	unclassified	probably benign
IGL02833:Psme4	APN	11	30850715	unclassified	probably benign
IGL02964:Psme4	APN	11	30791095	nonsense	probably null
IGL03273:Psme4	APN	11	30848130	missense	probably damaging	1.00
IGL03348:Psme4	APN	11	30876796	missense	probably damaging	1.00
IGL03382:Psme4	APN	11	30807788	missense	possibly damaging	0.94
H2330:Psme4	UTSW	11	30851210	missense	probably benign	0.17
PIT4378001:Psme4	UTSW	11	30821079	splice site	probably benign
R0276:Psme4	UTSW	11	30811980	missense	probably damaging	1.00
R0462:Psme4	UTSW	11	30848117	missense	probably damaging	1.00
R0685:Psme4	UTSW	11	30878415	missense	probably damaging	1.00
R0766:Psme4	UTSW	11	30807687	splice site	probably null
R0830:Psme4	UTSW	11	30807797	missense	possibly damaging	0.53
R0940:Psme4	UTSW	11	30815264	missense	possibly damaging	0.53
R1018:Psme4	UTSW	11	30804310	missense	probably damaging	1.00
R1312:Psme4	UTSW	11	30807687	splice site	probably null
R1448:Psme4	UTSW	11	30852744	missense	probably damaging	1.00
R1713:Psme4	UTSW	11	30806310	missense	probably damaging	1.00
R1732:Psme4	UTSW	11	30848105	missense	probably benign	0.03
R1813:Psme4	UTSW	11	30804353	missense	probably benign	0.14
R1905:Psme4	UTSW	11	30810922	missense	probably damaging	1.00
R1907:Psme4	UTSW	11	30810922	missense	probably damaging	1.00
R1911:Psme4	UTSW	11	30815658	missense	probably benign	0.02
R1956:Psme4	UTSW	11	30832424	missense	probably damaging	0.99
R1974:Psme4	UTSW	11	30819011	missense	probably benign	0.00
R1980:Psme4	UTSW	11	30832615	missense	possibly damaging	0.84
R1986:Psme4	UTSW	11	30830352	missense	probably benign	0.01
R2046:Psme4	UTSW	11	30817723	splice site	probably benign
R2142:Psme4	UTSW	11	30820998	missense	possibly damaging	0.89
R2698:Psme4	UTSW	11	30874282	critical splice donor site	probably null
R2844:Psme4	UTSW	11	30845173	splice site	probably benign
R3807:Psme4	UTSW	11	30856027	splice site	probably null
R3876:Psme4	UTSW	11	30856068	missense	probably damaging	0.99
R4420:Psme4	UTSW	11	30812028	missense	possibly damaging	0.67
R4584:Psme4	UTSW	11	30834318	missense	probably damaging	1.00
R4714:Psme4	UTSW	11	30832573	missense	probably benign	0.02
R5008:Psme4	UTSW	11	30856896	intron	probably benign
R5109:Psme4	UTSW	11	30791095	nonsense	probably null
R5155:Psme4	UTSW	11	30876806	missense	probably damaging	1.00
R5199:Psme4	UTSW	11	30853272	missense	probably benign	0.00
R5205:Psme4	UTSW	11	30832666	intron	probably benign
R5452:Psme4	UTSW	11	30791168	missense	probably benign
R5491:Psme4	UTSW	11	30815246	missense	possibly damaging	0.63
R5685:Psme4	UTSW	11	30809837	missense	probably damaging	0.99
R5764:Psme4	UTSW	11	30772364	intron	probably benign
R5853:Psme4	UTSW	11	30791234	critical splice donor site	probably null
R5865:Psme4	UTSW	11	30791993	missense	possibly damaging	0.95
R5903:Psme4	UTSW	11	30841589	missense	probably benign	0.28
R5927:Psme4	UTSW	11	30804294	missense	possibly damaging	0.82
R6004:Psme4	UTSW	11	30856896	intron	probably benign
R6102:Psme4	UTSW	11	30865567	missense	probably damaging	1.00
R6247:Psme4	UTSW	11	30853245	missense	possibly damaging	0.60
R6527:Psme4	UTSW	11	30832175	missense	probably benign
R6750:Psme4	UTSW	11	30853203	missense	probably damaging	1.00
R6885:Psme4	UTSW	11	30834307	nonsense	probably null
R6939:Psme4	UTSW	11	30837291	missense	probably damaging	0.99
R6945:Psme4	UTSW	11	30837437	missense	probably benign	0.06
R7029:Psme4	UTSW	11	30772474	intron	probably benign
R7049:Psme4	UTSW	11	30813904	splice site	probably null
R7098:Psme4	UTSW	11	30850661	missense	probably damaging	0.99
R7107:Psme4	UTSW	11	30848105	missense	probably benign	0.03
R7223:Psme4	UTSW	11	30874226	missense	probably benign	0.33
R7319:Psme4	UTSW	11	30807790	missense	probably benign	0.00
R7375:Psme4	UTSW	11	30772700	splice site	probably null
R7410:Psme4	UTSW	11	30815279	nonsense	probably null
R7469:Psme4	UTSW	11	30802837	missense	probably benign	0.20
R7651:Psme4	UTSW	11	30837334	missense	probably damaging	0.98
R7679:Psme4	UTSW	11	30878425	missense	probably damaging	0.99
R7681:Psme4	UTSW	11	30791975	missense	possibly damaging	0.63
R7822:Psme4	UTSW	11	30874245	missense	probably benign
R8013:Psme4	UTSW	11	30804320	missense	probably benign	0.06
R8130:Psme4	UTSW	11	30842026	missense	probably damaging	1.00
R8323:Psme4	UTSW	11	30843532	missense	probably damaging	0.99
R8330:Psme4	UTSW	11	30843583	missense	probably benign	0.00
R8363:Psme4	UTSW	11	30812139	missense	probably damaging	1.00
R8491:Psme4	UTSW	11	30772161	missense	possibly damaging	0.90
R8690:Psme4	UTSW	11	30837319	missense	probably benign	0.00
R8696:Psme4	UTSW	11	30809896	missense	probably damaging	0.99
R8743:Psme4	UTSW	11	30878467	missense	probably damaging	1.00
R8998:Psme4	UTSW	11	30838957	missense	possibly damaging	0.78
R9241:Psme4	UTSW	11	30865576	missense	probably damaging	1.00
R9657:Psme4	UTSW	11	30838980	missense	probably benign	0.00
R9736:Psme4	UTSW	11	30847411	missense	probably damaging	0.99
R9744:Psme4	UTSW	11	30815294	critical splice donor site	probably null
R9746:Psme4	UTSW	11	30876868	nonsense	probably null
V5088:Psme4	UTSW	11	30851210	missense	probably benign	0.17
X0063:Psme4	UTSW	11	30832600	missense	possibly damaging	0.66
Z1176:Psme4	UTSW	11	30843522	missense	possibly damaging	0.87
Z1177:Psme4	UTSW	11	30806311	missense	probably damaging	1.00
Z1177:Psme4	UTSW	11	30812138	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CAGGAATCCACTGTTGAAGTCAC -3'
(R):5'- TCTGAGGCACCCTATATGAGG -3'

Sequencing Primer
(F):5'- ATTTGTTTTCCAGCTCCATGG -3'
(R):5'- ATGAGGGATTGCTTAAGCTATACTG -3'

Posted On

2015-09-25