Mutagenetix > Incidental Mutations

Incidental Mutation 'R0103:Plxnb2'

34504

Institutional Source

Beutler Lab

Gene Symbol

Plxnb2

Ensembl Gene

ENSMUSG00000036606

Gene Name

plexin B2

Synonyms

Debt, 1110007H23Rik

MMRRC Submission

038389-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.956) question?

Stock #

R0103 (G1)

Quality Score

186

Status

Validated (trace)

Chromosome

Chromosomal Location

89155549-89180788 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 89161769 bp

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Histidine at position 968 (Y968H)

Ref Sequence

ENSEMBL: ENSMUSP00000104955 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000060808] [ENSMUST00000109331]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000060808
AA Change: Y968H

PolyPhen 2 Score 0.847 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000051731
Gene: ENSMUSG00000036606
AA Change: Y968H

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
Sema	34	452	8.87e-92	SMART
PSI	470	521	1.94e-10	SMART
PSI	616	669	4.09e-1	SMART
PSI	761	804	7.02e-8	SMART
IPT	805	896	8.14e-19	SMART
IPT	897	983	1.1e-15	SMART
IPT	985	1096	5.06e-6	SMART
Pfam:Plexin_cytopl	1275	1809	1.6e-225	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000109331
AA Change: Y968H

PolyPhen 2 Score 0.847 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000104955
Gene: ENSMUSG00000036606
AA Change: Y968H

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
Sema	34	452	8.87e-92	SMART
PSI	470	521	1.94e-10	SMART
PSI	616	669	4.09e-1	SMART
PSI	761	804	7.02e-8	SMART
IPT	805	896	8.14e-19	SMART
IPT	897	983	1.1e-15	SMART
IPT	985	1096	5.06e-6	SMART
Pfam:Plexin_cytopl	1274	1809	4.4e-251	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000131062

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000139372

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000151418

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000197760

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000229966

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000230393

Meta Mutation Damage Score

0.5800

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.0%
20x: 94.8%

Validation Efficiency

99% (84/85)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of the B class of plexins, such as PLXNB2 are transmembrane receptors that participate in axon guidance and cell migration in response to semaphorins (Perrot et al. (2002) [PubMed 12183458]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Homozygotes for a targeted mutation of this gene die perinatally of exencephaly or survive and seem normal despite severe abnormalities in cerebellar layering and foliation; the external granule cell layer is disorganized due to continued proliferation and migration of differentiated granule cells. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 84 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca13	A	C	11: 9,273,951	R443S	probably damaging	Het
Anapc1	T	C	2: 128,680,452		probably benign	Het
Aqr	T	A	2: 114,149,016	I313F	probably damaging	Het
Arfgap3	A	T	15: 83,322,721		probably benign	Het
Asah2	G	T	19: 32,018,977	H374N	probably benign	Het
Avl9	G	T	6: 56,736,483	R242L	probably benign	Het
Ccdc106	C	A	7: 5,057,545	Q35K	probably benign	Het
Ccm2l	G	T	2: 153,067,919	E64*	probably null	Het
Cep85l	A	T	10: 53,278,174	D776E	possibly damaging	Het
Cfap52	T	A	11: 67,925,125	I611F	possibly damaging	Het
Cldn22	C	T	8: 47,824,554	T9M	probably benign	Het
Coa7	T	C	4: 108,338,141	L89P	possibly damaging	Het
Cox7a2l	A	T	17: 83,514,272	Y2N	probably damaging	Het
Ctns	A	C	11: 73,185,311	I299M	probably damaging	Het
Cyp27a1	A	C	1: 74,735,915	E301A	probably benign	Het
Cyp2b13	A	T	7: 26,088,710	K421M	probably damaging	Het
Cyp4f40	G	T	17: 32,676,308	C468F	probably damaging	Het
Cyp4f40	C	A	17: 32,676,309	C468*	probably null	Het
Dcun1d5	G	A	9: 7,188,788	C74Y	probably damaging	Het
Dennd4c	A	G	4: 86,812,446	Y860C	probably benign	Het
Dgkz	T	C	2: 91,934,205	T1028A	probably benign	Het
Dhx58	T	C	11: 100,695,270	T642A	probably damaging	Het
Dlg4	A	G	11: 70,031,193	Y87C	probably damaging	Het
Dnah6	C	T	6: 73,092,172	E2511K	probably damaging	Het
Entpd5	C	A	12: 84,396,943	E9*	probably null	Het
Fbln2	A	C	6: 91,271,550	I1066L	probably benign	Het
Fhl2	C	T	1: 43,153,221	R4H	probably benign	Het
Frmpd1	T	A	4: 45,229,884	I17K	probably damaging	Het
Gbp7	T	A	3: 142,546,538	N627K	probably benign	Het
Gm20388	A	G	8: 122,269,733		probably benign	Het
Gnptab	A	G	10: 88,429,519	Y331C	probably damaging	Het
Hdac4	T	C	1: 91,975,644	E521G	possibly damaging	Het
Hibadh	T	A	6: 52,557,877	M173L	probably benign	Het
Iba57	C	T	11: 59,163,613	A27T	probably benign	Het
Itga1	T	C	13: 115,016,254	I211V	probably benign	Het
Keg1	A	T	19: 12,718,916	I155F	possibly damaging	Het
Krt84	T	C	15: 101,530,236	E272G	probably damaging	Het
Lrp2	C	A	2: 69,477,040	V2892L	probably benign	Het
Ltb	A	G	17: 35,195,040		probably benign	Het
Masp1	G	A	16: 23,458,018	P579L	probably damaging	Het
Mtor	T	A	4: 148,533,902	M1724K	probably benign	Het
Myo3a	T	G	2: 22,544,322		probably benign	Het
Myo9b	C	T	8: 71,323,849		probably benign	Het
Ncor1	G	T	11: 62,343,045	Q444K	possibly damaging	Het
Nek7	A	T	1: 138,544,242	C53*	probably null	Het
Obscn	G	T	11: 59,062,696	Y4044*	probably null	Het
Olfr1458	G	A	19: 13,103,278	R3C	possibly damaging	Het
Pcdh15	A	T	10: 74,210,425	D178V	probably damaging	Het
Pcsk6	T	C	7: 65,929,097		probably benign	Het
Phxr4	T	C	9: 13,431,791		probably benign	Het
Pkhd1	T	A	1: 20,523,359	D1510V	probably benign	Het
Pkhd1l1	T	C	15: 44,597,141	C4249R	probably benign	Het
Prpf39	T	C	12: 65,055,283	V378A	possibly damaging	Het
Psd2	A	G	18: 36,004,717	N455S	probably damaging	Het
Ptch2	C	A	4: 117,109,425		probably benign	Het
Rab4b	A	G	7: 27,174,502	I117T	probably benign	Het
Rad9b	A	T	5: 122,331,527	V348E	probably damaging	Het
Rcor1	T	C	12: 111,109,778		probably benign	Het
Rhoc	A	T	3: 104,791,991	E32V	possibly damaging	Het
Rnf40	T	G	7: 127,600,571	V925G	probably damaging	Het
Rptor	G	T	11: 119,884,967	R988L	probably benign	Het
Slc25a32	A	T	15: 39,099,897	Y176*	probably null	Het
Slc7a1	T	A	5: 148,352,426	K4*	probably null	Het
Ss18	A	C	18: 14,679,421	Y38D	probably damaging	Het
Syt4	T	A	18: 31,447,220		probably benign	Het
Taar4	A	T	10: 23,961,406	N305Y	probably damaging	Het
Taar7b	A	T	10: 24,000,294	Y119F	probably benign	Het
Tcaf1	G	T	6: 42,686,390	D185E	probably benign	Het
Tmem138	T	C	19: 10,574,952	N62S	possibly damaging	Het
Tnfaip2	C	T	12: 111,445,810	T215M	probably benign	Het
Tnfrsf21	C	T	17: 43,038,213	H239Y	probably benign	Het
Tnfrsf25	C	T	4: 152,116,948	P65S	possibly damaging	Het
Trp53bp1	A	T	2: 121,236,759	S495R	possibly damaging	Het
Trpv3	T	C	11: 73,293,979	F597S	probably damaging	Het
Tsc22d4	A	C	5: 137,747,116	M1L	possibly damaging	Het
Ttc39a	A	G	4: 109,421,453		probably null	Het
Ttn	T	G	2: 76,761,226	H21033P	probably damaging	Het
Ugt2a3	A	G	5: 87,336,718	V149A	possibly damaging	Het
Ush2a	T	G	1: 188,319,070	I251R	possibly damaging	Het
Vamp4	T	C	1: 162,589,539	C114R	possibly damaging	Het
Wdr33	T	C	18: 31,833,335	V135A	probably damaging	Het
Zc3h13	T	A	14: 75,330,468	V1067E	probably damaging	Het
Zcwpw1	G	A	5: 137,810,113	W274*	probably null	Het
Zfp219	T	A	14: 52,006,706	H627L	probably damaging	Het

Other mutations in Plxnb2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00546:Plxnb2	APN	15	89162366	splice site	probably benign
IGL01574:Plxnb2	APN	15	89162683	splice site	probably null
IGL01695:Plxnb2	APN	15	89157214	missense	possibly damaging	0.96
IGL01763:Plxnb2	APN	15	89161981	splice site	probably null
IGL01921:Plxnb2	APN	15	89164271	missense	possibly damaging	0.78
IGL02129:Plxnb2	APN	15	89160410	missense	probably benign	0.04
IGL02153:Plxnb2	APN	15	89165813	nonsense	probably null
IGL02637:Plxnb2	APN	15	89164057	missense	possibly damaging	0.53
IGL02892:Plxnb2	APN	15	89161222	critical splice donor site	probably null
IGL03108:Plxnb2	APN	15	89158031	missense	probably benign	0.32
IGL03115:Plxnb2	APN	15	89162438	splice site	probably benign
P0040:Plxnb2	UTSW	15	89162935	missense	probably damaging	1.00
R0022:Plxnb2	UTSW	15	89163276	critical splice donor site	probably null
R0095:Plxnb2	UTSW	15	89165331	missense	probably benign
R0544:Plxnb2	UTSW	15	89158613	splice site	probably benign
R0671:Plxnb2	UTSW	15	89157981	missense	probably benign	0.14
R1279:Plxnb2	UTSW	15	89162321	missense	probably benign	0.02
R1530:Plxnb2	UTSW	15	89167192	missense	probably benign
R1542:Plxnb2	UTSW	15	89165921	missense	probably damaging	1.00
R1610:Plxnb2	UTSW	15	89158493	missense	probably damaging	1.00
R1686:Plxnb2	UTSW	15	89162462	missense	probably damaging	1.00
R1702:Plxnb2	UTSW	15	89161984	critical splice donor site	probably null
R1996:Plxnb2	UTSW	15	89158768	missense	probably benign	0.13
R1997:Plxnb2	UTSW	15	89158768	missense	probably benign	0.13
R2031:Plxnb2	UTSW	15	89162810	nonsense	probably null
R2049:Plxnb2	UTSW	15	89159002	missense	probably damaging	1.00
R2072:Plxnb2	UTSW	15	89158451	missense	probably damaging	1.00
R2076:Plxnb2	UTSW	15	89158026	missense	probably damaging	1.00
R2140:Plxnb2	UTSW	15	89156562	missense	probably benign	0.04
R2418:Plxnb2	UTSW	15	89161069	missense	possibly damaging	0.72
R2419:Plxnb2	UTSW	15	89161069	missense	possibly damaging	0.72
R3752:Plxnb2	UTSW	15	89157255	splice site	probably benign
R3825:Plxnb2	UTSW	15	89166399	missense	probably benign	0.05
R4154:Plxnb2	UTSW	15	89159642	missense	probably damaging	0.98
R4197:Plxnb2	UTSW	15	89157018	missense	probably damaging	1.00
R4385:Plxnb2	UTSW	15	89160623	missense	probably damaging	0.96
R4434:Plxnb2	UTSW	15	89162803	missense	probably damaging	1.00
R4678:Plxnb2	UTSW	15	89160928	missense	probably benign	0.37
R4717:Plxnb2	UTSW	15	89157419	nonsense	probably null
R4773:Plxnb2	UTSW	15	89166947	missense	probably benign	0.06
R4905:Plxnb2	UTSW	15	89157411	missense	probably damaging	1.00
R5368:Plxnb2	UTSW	15	89159593	missense	possibly damaging	0.94
R5418:Plxnb2	UTSW	15	89166491	missense	probably benign	0.00
R5484:Plxnb2	UTSW	15	89164209	splice site	probably null
R5520:Plxnb2	UTSW	15	89167543	missense	possibly damaging	0.65
R5566:Plxnb2	UTSW	15	89164020	missense	probably benign	0.05
R5568:Plxnb2	UTSW	15	89157435	missense	probably damaging	1.00
R5619:Plxnb2	UTSW	15	89162809	missense	possibly damaging	0.92
R5685:Plxnb2	UTSW	15	89167032	missense	probably damaging	1.00
R5688:Plxnb2	UTSW	15	89158696	missense	probably damaging	1.00
R5809:Plxnb2	UTSW	15	89167571	missense	possibly damaging	0.61
R5813:Plxnb2	UTSW	15	89160759	missense	possibly damaging	0.81
R5866:Plxnb2	UTSW	15	89167572	missense	probably damaging	1.00
R6016:Plxnb2	UTSW	15	89161022	missense	possibly damaging	0.55
R6117:Plxnb2	UTSW	15	89158000	missense	probably benign	0.04
R6187:Plxnb2	UTSW	15	89167258	missense	probably damaging	1.00
R6260:Plxnb2	UTSW	15	89165291	missense	probably benign	0.22
R6263:Plxnb2	UTSW	15	89161986	missense	probably damaging	0.99
R6269:Plxnb2	UTSW	15	89160713	missense	probably benign	0.18
R6351:Plxnb2	UTSW	15	89157770	missense	possibly damaging	0.95
R6522:Plxnb2	UTSW	15	89164426	missense	probably benign	0.18
R6856:Plxnb2	UTSW	15	89164320	missense	probably benign	0.27
R6930:Plxnb2	UTSW	15	89160389	missense	probably benign
R7354:Plxnb2	UTSW	15	89165725	missense	possibly damaging	0.92
R7513:Plxnb2	UTSW	15	89158322	critical splice acceptor site	probably null
R7522:Plxnb2	UTSW	15	89161774	missense	probably benign	0.20
R7730:Plxnb2	UTSW	15	89162330	missense	probably benign
R7766:Plxnb2	UTSW	15	89161271	missense	probably benign	0.01
R7781:Plxnb2	UTSW	15	89157022	missense	possibly damaging	0.89
X0027:Plxnb2	UTSW	15	89160713	missense	probably benign	0.18

Predicted Primers

PCR Primer
(F):5'- TCTAAGGAGGAAGCCCATCAGAGTG -3'
(R):5'- CCCTTGTGAAGTGTATGTGTCGCC -3'

Sequencing Primer
(F):5'- AGCCCATCAGAGTGCAGTG -3'
(R):5'- TCTGGGGAGAGGGTGGG -3'

Posted On

2013-05-09