Incidental Mutation 'R4615:Gng2'
ID345042
Institutional Source Beutler Lab
Gene Symbol Gng2
Ensembl Gene ENSMUSG00000043004
Gene Nameguanine nucleotide binding protein (G protein), gamma 2
Synonyms1110003P13Rik
MMRRC Submission 041826-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.128) question?
Stock #R4615 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location19872559-19977627 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 19891327 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 16 (V16I)
Ref Sequence ENSEMBL: ENSMUSP00000124153 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055100] [ENSMUST00000159028] [ENSMUST00000159073] [ENSMUST00000160013] [ENSMUST00000161247] [ENSMUST00000162425]
Predicted Effect possibly damaging
Transcript: ENSMUST00000055100
AA Change: V16I

PolyPhen 2 Score 0.857 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000055256
Gene: ENSMUSG00000043004
AA Change: V16I

DomainStartEndE-ValueType
G_gamma 5 70 5.6e-29 SMART
GGL 9 70 4.2e-34 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000159028
AA Change: V16I

PolyPhen 2 Score 0.857 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000125141
Gene: ENSMUSG00000043004
AA Change: V16I

DomainStartEndE-ValueType
G_gamma 5 70 5.6e-29 SMART
GGL 9 70 4.2e-34 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000159073
AA Change: V16I

PolyPhen 2 Score 0.619 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000125000
Gene: ENSMUSG00000043004
AA Change: V16I

DomainStartEndE-ValueType
G_gamma 5 70 5.6e-29 SMART
GGL 9 70 4.2e-34 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000160013
AA Change: V16I

PolyPhen 2 Score 0.857 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000125697
Gene: ENSMUSG00000043004
AA Change: V16I

DomainStartEndE-ValueType
G_gamma 5 70 5.7e-29 SMART
GGL 9 70 4.3e-34 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000161247
AA Change: V16I

PolyPhen 2 Score 0.857 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000124725
Gene: ENSMUSG00000043004
AA Change: V16I

DomainStartEndE-ValueType
G_gamma 5 70 5.6e-29 SMART
GGL 9 70 4.2e-34 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000162425
AA Change: V16I

PolyPhen 2 Score 0.857 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000124153
Gene: ENSMUSG00000043004
AA Change: V16I

DomainStartEndE-ValueType
G_gamma 5 70 5.6e-29 SMART
GGL 9 70 4.2e-34 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the gamma subunits of a guanine nucleotide-binding protein. Such proteins are involved in signaling mechanisms across membranes. Various subunits forms heterodimers which then interact with the different signal molecules. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced vomeronasal basal neurons, reduced posterior glomerular layer of the accessory olfactory bulb and decreased aggression towards male mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 T C 1: 71,330,334 I363V probably benign Het
Abcc9 C G 6: 142,689,107 A144P possibly damaging Het
Adgrv1 C T 13: 81,494,569 probably null Het
Adprhl1 A G 8: 13,242,250 probably null Het
Angptl3 A T 4: 99,031,361 E119D probably benign Het
Atp8b1 T C 18: 64,553,099 N671S probably null Het
C9 A G 15: 6,491,463 D51G probably damaging Het
Carmil2 A G 8: 105,695,074 D1019G possibly damaging Het
Cdh8 A T 8: 99,279,622 I111K probably damaging Het
Cep120 T C 18: 53,714,841 R649G probably damaging Het
Clptm1l A T 13: 73,607,738 K158* probably null Het
Cmtm1 CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT 8: 104,309,470 probably benign Het
Cnga1 A C 5: 72,604,774 L466V probably damaging Het
Cpsf1 T C 15: 76,596,937 T1240A possibly damaging Het
Cubn A G 2: 13,428,749 S1117P probably damaging Het
Cyp2b9 T A 7: 26,201,125 L396Q probably damaging Het
Cyp8b1 A T 9: 121,916,098 L56* probably null Het
Dcbld2 A G 16: 58,456,094 T458A probably benign Het
Dio2 G T 12: 90,729,821 P131Q probably damaging Het
Dlg5 T C 14: 24,158,168 Y990C probably damaging Het
Dsc3 T C 18: 19,971,488 D594G possibly damaging Het
Dsp A G 13: 38,191,632 E1131G probably damaging Het
Fdx1 A T 9: 51,948,645 Y21* probably null Het
Gal3st4 A G 5: 138,266,263 V158A probably damaging Het
Gm10269 T A 18: 20,682,763 E67D probably benign Het
Gm5773 A G 3: 93,774,032 H337R probably benign Het
Gm7102 C T 19: 61,175,926 G24R unknown Het
Gpr20 T C 15: 73,695,736 N268S probably benign Het
Ighv1-82 T C 12: 115,952,660 T77A probably benign Het
Lama2 C A 10: 26,981,524 V3110F probably damaging Het
Mtmr4 T C 11: 87,610,935 L548S probably damaging Het
Ncapg A T 5: 45,687,399 M579L probably benign Het
Olfr1338 T C 4: 118,754,137 T134A probably benign Het
Olfr292 T C 7: 86,694,728 S91P probably damaging Het
Oog3 A T 4: 144,158,329 Y346N probably benign Het
Orm2 A G 4: 63,363,299 D89G probably damaging Het
Pcdhb4 T A 18: 37,308,500 S288T probably benign Het
Pcsk2 G T 2: 143,795,969 C375F probably damaging Het
Pdcd10 T C 3: 75,521,091 I138M probably damaging Het
Pde8a T C 7: 81,320,737 W536R probably damaging Het
Phkg2 C T 7: 127,577,620 R61W probably damaging Het
Plcl1 A T 1: 55,698,134 N878I probably benign Het
Prkdc A T 16: 15,663,074 D353V probably damaging Het
Psme4 C T 11: 30,834,287 T954I probably benign Het
Ran A G 5: 129,022,098 I115V probably benign Het
Reln A G 5: 21,972,872 L1867P possibly damaging Het
S100a1 A G 3: 90,511,255 V84A possibly damaging Het
Sall2 G A 14: 52,312,750 P994L probably benign Het
Shtn1 A T 19: 59,022,216 I273N probably benign Het
Slc17a9 T C 2: 180,731,906 I40T probably benign Het
Slc29a2 T C 19: 5,029,264 V305A probably damaging Het
Ssfa2 A G 2: 79,662,382 E1091G probably damaging Het
Taar2 T A 10: 23,941,365 F268I probably benign Het
Taf3 G A 2: 9,952,090 T422I probably damaging Het
Tgs1 T C 4: 3,585,156 F99L probably damaging Het
Tox2 T C 2: 163,320,647 L479P probably damaging Het
Ttn A G 2: 76,766,875 I19898T probably damaging Het
Ulk1 G T 5: 110,789,046 T3N probably damaging Het
Vars A T 17: 35,013,881 K900N probably damaging Het
Vmn2r15 A G 5: 109,293,482 V170A possibly damaging Het
Vmn2r53 A T 7: 12,582,302 L530Q probably damaging Het
Zar1l G T 5: 150,518,063 Q33K probably benign Het
Zdhhc16 T C 19: 41,943,683 V358A possibly damaging Het
Other mutations in Gng2
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0883:Gng2 UTSW 14 19891295 missense probably benign 0.04
R4827:Gng2 UTSW 14 19875830 missense possibly damaging 0.90
R5460:Gng2 UTSW 14 19891358 missense probably benign 0.42
R5840:Gng2 UTSW 14 19875814 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- GGACCCCACTTCAATGCATATC -3'
(R):5'- ACCAGCAGTGTTTTGAGGTC -3'

Sequencing Primer
(F):5'- GTATCAGTGGAATTGTTAGAACCCTC -3'
(R):5'- CAGTGTTTTGAGGTCCACCAG -3'
Posted On2015-09-25