Mutagenetix > Incidental Mutations

Incidental Mutation 'R4618:Gins1'

345070

Institutional Source

Beutler Lab

Gene Symbol

Gins1

Ensembl Gene

ENSMUSG00000027454

Gene Name

GINS complex subunit 1 (Psf1 homolog)

Synonyms

Psf1, 2810418N01Rik

MMRRC Submission

041884-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R4618 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

150905400-150931280 bp(+) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

T to A at 150917861 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000028948 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028948] [ENSMUST00000028948] [ENSMUST00000028948]

Predicted Effect

probably null
Transcript: ENSMUST00000028948

SMART Domains

Protein: ENSMUSP00000028948
Gene: ENSMUSG00000027454

Domain	Start	End	E-Value	Type
PDB:2Q9Q\|G	1	196	1e-141	PDB
Blast:KISc	112	188	3e-17	BLAST

Predicted Effect

probably null
Transcript: ENSMUST00000028948

SMART Domains

Protein: ENSMUSP00000028948
Gene: ENSMUSG00000027454

Domain	Start	End	E-Value	Type
PDB:2Q9Q\|G	1	196	1e-141	PDB
Blast:KISc	112	188	3e-17	BLAST

Predicted Effect

probably null
Transcript: ENSMUST00000028948

SMART Domains

Protein: ENSMUSP00000028948
Gene: ENSMUSG00000027454

Domain	Start	End	E-Value	Type
PDB:2Q9Q\|G	1	196	1e-141	PDB
Blast:KISc	112	188	3e-17	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000123217

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000140950

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000152991

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.2%

Validation Efficiency

98% (89/91)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The yeast heterotetrameric GINS complex is made up of Sld5 (GINS4; MIM 610611), Psf1, Psf2 (GINS2; MIM 610609), and Psf3 (GINS3; MIM 610610). The formation of the GINS complex is essential for the initiation of DNA replication in yeast and Xenopus egg extracts (Ueno et al., 2005 [PubMed 16287864]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Embryos homozygous for a knock-out allele display disorganized embryonic and extraembryonic structures and fail to develop past E5.5; mutant blastocysts fail to exhibit outgrowth in culture and show a cell proliferation defect and inner cell mass apoptosis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 77 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930432M17Rik	A	T	3: 121,679,446	K83N	unknown	Het
Adamtsl3	T	A	7: 82,606,520	M1580K	probably benign	Het
Adprhl1	A	G	8: 13,242,250		probably null	Het
Akap3	G	T	6: 126,866,443	C675F	probably benign	Het
Asap1	A	T	15: 64,152,895	H318Q	probably damaging	Het
Atf7ip	G	T	6: 136,565,106	A18S	probably damaging	Het
Bcl2a1a	A	C	9: 88,957,304	N85T	probably damaging	Het
Btnl6	G	A	17: 34,514,146	P248S	probably damaging	Het
C9	A	G	15: 6,491,463	D51G	probably damaging	Het
Ccdc14	T	A	16: 34,706,495	C257S	probably benign	Het
Cd5l	A	G	3: 87,368,619	T299A	probably benign	Het
Endou	C	T	15: 97,713,882	V292M	possibly damaging	Het
Fbxo36	T	C	1: 84,900,028	I137T	probably damaging	Het
Fcer1a	T	C	1: 173,222,641	I161V	possibly damaging	Het
Fsip2	A	G	2: 82,987,759	Y4612C	probably benign	Het
Gcnt2	T	A	13: 40,958,194	L353*	probably null	Het
Ghrhr	T	C	6: 55,381,754	F172S	probably damaging	Het
Gm16519	T	G	17: 70,929,242	L62R	probably damaging	Het
Gm4758	T	A	16: 36,312,590	D76E	possibly damaging	Het
Gpr20	T	C	15: 73,695,736	N268S	probably benign	Het
Greb1l	A	G	18: 10,498,965	T283A	probably benign	Het
Grin2c	T	A	11: 115,252,747	D729V	probably damaging	Het
Heatr4	T	G	12: 83,978,067	T327P	probably damaging	Het
Hes2	A	C	4: 152,160,388	S105R	probably benign	Het
Hsph1	A	G	5: 149,618,843	V705A	probably benign	Het
Ighv1-82	T	C	12: 115,952,660	T77A	probably benign	Het
Itih1	A	T	14: 30,929,831	D851E	probably benign	Het
Klhdc7b	A	G	15: 89,387,269	T785A	probably benign	Het
Lmbr1	G	T	5: 29,346,865	A74E	probably damaging	Het
Lonp1	A	C	17: 56,622,511	H175Q	probably benign	Het
Maml2	T	C	9: 13,620,075	F195S	probably damaging	Het
Man2b2	G	T	5: 36,817,639	T436K	probably benign	Het
Man2c1	T	C	9: 57,142,155		probably null	Het
Mettl11b	A	T	1: 163,725,028	F10I	probably damaging	Het
Mrps15	G	A	4: 126,047,044		probably benign	Het
Mtrf1l	C	A	10: 5,817,586	V177F	probably benign	Het
Naxd	A	T	8: 11,509,489	I213F	probably damaging	Het
Nbeal1	T	A	1: 60,228,731		probably benign	Het
Nfatc1	T	C	18: 80,697,832	I318V	probably damaging	Het
Nid2	T	A	14: 19,808,010	I1297N	probably damaging	Het
Nol10	T	C	12: 17,348,561	V3A	probably damaging	Het
Nop14	G	T	5: 34,639,218	P765Q	probably damaging	Het
Noxa1	C	T	2: 25,091,749	G114D	probably damaging	Het
Olfr1100	A	G	2: 86,978,274	I174T	possibly damaging	Het
Olfr1342	A	T	4: 118,689,470		probably benign	Het
Olfr714	G	A	7: 107,074,554	C242Y	probably damaging	Het
Olfr73	A	G	2: 88,034,554	V195A	probably benign	Het
Opa1	T	C	16: 29,587,039	W141R	probably damaging	Het
Pde4d	A	T	13: 109,933,877	M7L	probably benign	Het
Phykpl	G	A	11: 51,592,229	A188T	probably damaging	Het
Pkd2l1	C	A	19: 44,154,134	A490S	probably damaging	Het
Pkhd1l1	T	A	15: 44,539,682	V2260D	probably damaging	Het
Ptprt	T	C	2: 161,553,845	E1136G	probably damaging	Het
Rad21	A	T	15: 51,970,024	L353Q	probably damaging	Het
Rfx4	G	T	10: 84,880,896	A425S	probably benign	Het
Rnf38	A	G	4: 44,142,450	S169P	probably damaging	Het
Samd9l	C	A	6: 3,376,347	V305F	probably damaging	Het
Serpini1	A	G	3: 75,616,576	K164E	probably benign	Het
Sirt6	A	G	10: 81,626,574	L37P	probably damaging	Het
Sorbs1	T	C	19: 40,373,518	T141A	probably damaging	Het
Tacc2	A	T	7: 130,626,216	T1563S	probably benign	Het
Tbc1d14	A	C	5: 36,530,381		probably benign	Het
Tbrg4	G	A	11: 6,620,185		probably benign	Het
Tox2	T	C	2: 163,320,647	L479P	probably damaging	Het
Tpp1	A	T	7: 105,751,706	L38Q	probably benign	Het
Trhr	A	G	15: 44,197,641	N186D	probably benign	Het
Trmt1l	C	T	1: 151,454,048	Q581*	probably null	Het
Tsen54	T	A	11: 115,815,421		probably benign	Het
Tsg101	A	G	7: 46,892,509	I138T	possibly damaging	Het
Usp22	A	G	11: 61,161,443	S237P	probably damaging	Het
Vmn1r209	A	G	13: 22,806,449	S24P	possibly damaging	Het
Vmn2r18	A	T	5: 151,584,959	H233Q	possibly damaging	Het
Vmn2r45	A	T	7: 8,483,437	I284N	probably benign	Het
Vmn2r66	T	C	7: 84,995,088	I705V	possibly damaging	Het
Vsig1	G	T	X: 140,926,386	A95S	probably benign	Het
Zdhhc11	T	A	13: 73,979,230	M242K	probably benign	Het
Zfp352	A	G	4: 90,225,081	K486R	probably benign	Het

Other mutations in Gins1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
R1352:Gins1	UTSW	2	150930848	nonsense	probably null
R1575:Gins1	UTSW	2	150912838	missense	probably benign
R4361:Gins1	UTSW	2	150925901	missense	probably damaging	1.00
R4362:Gins1	UTSW	2	150909762	missense	probably damaging	1.00
R5769:Gins1	UTSW	2	150925998	missense	probably damaging	0.99
R6642:Gins1	UTSW	2	150928118	critical splice donor site	probably null
R6700:Gins1	UTSW	2	150916228	missense	probably damaging	1.00
R7038:Gins1	UTSW	2	150917871	missense	probably damaging	1.00
R7072:Gins1	UTSW	2	150909751	splice site	probably null
R7325:Gins1	UTSW	2	150916166	missense	probably benign
R8458:Gins1	UTSW	2	150930887	missense	probably benign	0.32

Predicted Primers

PCR Primer
(F):5'- TCGTGGCCTTTGTAACTACTGC -3'
(R):5'- CCGAGTTAGAAATTGATGAGTAGTC -3'

Sequencing Primer
(F):5'- CTGGCCTTGAACTCATGGAGATC -3'
(R):5'- GTCATTGAAAACAAAGAAACACTGG -3'

Posted On

2015-09-25