Incidental Mutation 'R4618:Tox2'
ID345072
Institutional Source Beutler Lab
Gene Symbol Tox2
Ensembl Gene ENSMUSG00000074607
Gene NameTOX high mobility group box family member 2
SynonymsLOC269389, RxHMG1
MMRRC Submission 041884-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4618 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location163203125-163324170 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 163320647 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 479 (L479P)
Ref Sequence ENSEMBL: ENSMUSP00000096710 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099110] [ENSMUST00000109428] [ENSMUST00000165937]
Predicted Effect probably damaging
Transcript: ENSMUST00000099110
AA Change: L479P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000096710
Gene: ENSMUSG00000074607
AA Change: L479P

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
low complexity region 20 35 N/A INTRINSIC
low complexity region 110 122 N/A INTRINSIC
low complexity region 232 248 N/A INTRINSIC
HMG 287 357 1.44e-18 SMART
low complexity region 424 451 N/A INTRINSIC
low complexity region 457 471 N/A INTRINSIC
low complexity region 499 524 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000109428
AA Change: L437P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000105055
Gene: ENSMUSG00000074607
AA Change: L437P

DomainStartEndE-ValueType
low complexity region 68 80 N/A INTRINSIC
low complexity region 190 206 N/A INTRINSIC
HMG 245 315 1.44e-18 SMART
low complexity region 382 409 N/A INTRINSIC
low complexity region 415 429 N/A INTRINSIC
low complexity region 457 482 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000148599
AA Change: L90P
SMART Domains Protein: ENSMUSP00000118219
Gene: ENSMUSG00000074607
AA Change: L90P

DomainStartEndE-ValueType
low complexity region 36 63 N/A INTRINSIC
low complexity region 69 83 N/A INTRINSIC
low complexity region 111 136 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000165937
AA Change: L444P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000126243
Gene: ENSMUSG00000074607
AA Change: L444P

DomainStartEndE-ValueType
low complexity region 75 87 N/A INTRINSIC
low complexity region 197 213 N/A INTRINSIC
HMG 252 322 1.44e-18 SMART
low complexity region 389 416 N/A INTRINSIC
low complexity region 422 436 N/A INTRINSIC
low complexity region 464 489 N/A INTRINSIC
Meta Mutation Damage Score 0.4258 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 98% (89/91)
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930432M17Rik A T 3: 121,679,446 K83N unknown Het
Adamtsl3 T A 7: 82,606,520 M1580K probably benign Het
Adprhl1 A G 8: 13,242,250 probably null Het
Akap3 G T 6: 126,866,443 C675F probably benign Het
Asap1 A T 15: 64,152,895 H318Q probably damaging Het
Atf7ip G T 6: 136,565,106 A18S probably damaging Het
Bcl2a1a A C 9: 88,957,304 N85T probably damaging Het
Btnl6 G A 17: 34,514,146 P248S probably damaging Het
C9 A G 15: 6,491,463 D51G probably damaging Het
Ccdc14 T A 16: 34,706,495 C257S probably benign Het
Cd5l A G 3: 87,368,619 T299A probably benign Het
Endou C T 15: 97,713,882 V292M possibly damaging Het
Fbxo36 T C 1: 84,900,028 I137T probably damaging Het
Fcer1a T C 1: 173,222,641 I161V possibly damaging Het
Fsip2 A G 2: 82,987,759 Y4612C probably benign Het
Gcnt2 T A 13: 40,958,194 L353* probably null Het
Ghrhr T C 6: 55,381,754 F172S probably damaging Het
Gins1 T A 2: 150,917,861 probably null Het
Gm16519 T G 17: 70,929,242 L62R probably damaging Het
Gm4758 T A 16: 36,312,590 D76E possibly damaging Het
Gpr20 T C 15: 73,695,736 N268S probably benign Het
Greb1l A G 18: 10,498,965 T283A probably benign Het
Grin2c T A 11: 115,252,747 D729V probably damaging Het
Heatr4 T G 12: 83,978,067 T327P probably damaging Het
Hes2 A C 4: 152,160,388 S105R probably benign Het
Hsph1 A G 5: 149,618,843 V705A probably benign Het
Ighv1-82 T C 12: 115,952,660 T77A probably benign Het
Itih1 A T 14: 30,929,831 D851E probably benign Het
Klhdc7b A G 15: 89,387,269 T785A probably benign Het
Lmbr1 G T 5: 29,346,865 A74E probably damaging Het
Lonp1 A C 17: 56,622,511 H175Q probably benign Het
Maml2 T C 9: 13,620,075 F195S probably damaging Het
Man2b2 G T 5: 36,817,639 T436K probably benign Het
Man2c1 T C 9: 57,142,155 probably null Het
Mettl11b A T 1: 163,725,028 F10I probably damaging Het
Mrps15 G A 4: 126,047,044 probably benign Het
Mtrf1l C A 10: 5,817,586 V177F probably benign Het
Naxd A T 8: 11,509,489 I213F probably damaging Het
Nbeal1 T A 1: 60,228,731 probably benign Het
Nfatc1 T C 18: 80,697,832 I318V probably damaging Het
Nid2 T A 14: 19,808,010 I1297N probably damaging Het
Nol10 T C 12: 17,348,561 V3A probably damaging Het
Nop14 G T 5: 34,639,218 P765Q probably damaging Het
Noxa1 C T 2: 25,091,749 G114D probably damaging Het
Olfr1100 A G 2: 86,978,274 I174T possibly damaging Het
Olfr1342 A T 4: 118,689,470 probably benign Het
Olfr714 G A 7: 107,074,554 C242Y probably damaging Het
Olfr73 A G 2: 88,034,554 V195A probably benign Het
Opa1 T C 16: 29,587,039 W141R probably damaging Het
Pde4d A T 13: 109,933,877 M7L probably benign Het
Phykpl G A 11: 51,592,229 A188T probably damaging Het
Pkd2l1 C A 19: 44,154,134 A490S probably damaging Het
Pkhd1l1 T A 15: 44,539,682 V2260D probably damaging Het
Ptprt T C 2: 161,553,845 E1136G probably damaging Het
Rad21 A T 15: 51,970,024 L353Q probably damaging Het
Rfx4 G T 10: 84,880,896 A425S probably benign Het
Rnf38 A G 4: 44,142,450 S169P probably damaging Het
Samd9l C A 6: 3,376,347 V305F probably damaging Het
Serpini1 A G 3: 75,616,576 K164E probably benign Het
Sirt6 A G 10: 81,626,574 L37P probably damaging Het
Sorbs1 T C 19: 40,373,518 T141A probably damaging Het
Tacc2 A T 7: 130,626,216 T1563S probably benign Het
Tbc1d14 A C 5: 36,530,381 probably benign Het
Tbrg4 G A 11: 6,620,185 probably benign Het
Tpp1 A T 7: 105,751,706 L38Q probably benign Het
Trhr A G 15: 44,197,641 N186D probably benign Het
Trmt1l C T 1: 151,454,048 Q581* probably null Het
Tsen54 T A 11: 115,815,421 probably benign Het
Tsg101 A G 7: 46,892,509 I138T possibly damaging Het
Usp22 A G 11: 61,161,443 S237P probably damaging Het
Vmn1r209 A G 13: 22,806,449 S24P possibly damaging Het
Vmn2r18 A T 5: 151,584,959 H233Q possibly damaging Het
Vmn2r45 A T 7: 8,483,437 I284N probably benign Het
Vmn2r66 T C 7: 84,995,088 I705V possibly damaging Het
Vsig1 G T X: 140,926,386 A95S probably benign Het
Zdhhc11 T A 13: 73,979,230 M242K probably benign Het
Zfp352 A G 4: 90,225,081 K486R probably benign Het
Other mutations in Tox2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01444:Tox2 APN 2 163225466 utr 5 prime probably benign
IGL01891:Tox2 APN 2 163322983 missense possibly damaging 0.48
IGL02190:Tox2 APN 2 163323006 missense possibly damaging 0.91
IGL02576:Tox2 APN 2 163276180 missense probably damaging 0.99
R0881:Tox2 UTSW 2 163321445 missense probably benign 0.18
R1739:Tox2 UTSW 2 163247785 missense probably damaging 0.99
R1742:Tox2 UTSW 2 163225526 missense probably benign 0.04
R1900:Tox2 UTSW 2 163276167 missense probably damaging 1.00
R1937:Tox2 UTSW 2 163225556 missense probably benign
R2345:Tox2 UTSW 2 163319598 missense probably damaging 1.00
R2842:Tox2 UTSW 2 163204630 intron probably benign
R3753:Tox2 UTSW 2 163314323 missense probably damaging 1.00
R4614:Tox2 UTSW 2 163320647 missense probably damaging 1.00
R4615:Tox2 UTSW 2 163320647 missense probably damaging 1.00
R4616:Tox2 UTSW 2 163320647 missense probably damaging 1.00
R4625:Tox2 UTSW 2 163314416 missense possibly damaging 0.71
R5410:Tox2 UTSW 2 163320373 missense probably benign 0.04
R5493:Tox2 UTSW 2 163204729 nonsense probably null
R6731:Tox2 UTSW 2 163320377 missense probably damaging 1.00
R6965:Tox2 UTSW 2 163323010 makesense probably null
R7038:Tox2 UTSW 2 163314344 missense probably damaging 0.99
R7078:Tox2 UTSW 2 163320581 missense
R7422:Tox2 UTSW 2 163321515 missense
R7577:Tox2 UTSW 2 163315902 nonsense probably null
R7829:Tox2 UTSW 2 163320376 missense probably damaging 1.00
R8356:Tox2 UTSW 2 163204630 missense unknown
R8456:Tox2 UTSW 2 163204630 missense unknown
RF011:Tox2 UTSW 2 163225564 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TGAGGCCAAGAACACTCAGG -3'
(R):5'- TTGAGAGAGCCAATGTCTCTCC -3'

Sequencing Primer
(F):5'- AGCAGCCCATGTACGCC -3'
(R):5'- CTCCAGGCAGGTGTTTTAGACC -3'
Posted On2015-09-25