Incidental Mutation 'R4618:Olfr1342'
ID 345079
Institutional Source Beutler Lab
Gene Symbol Olfr1342
Ensembl Gene ENSMUSG00000043383
Gene Name olfactory receptor 1342
Synonyms GA_x6K02T2QD9B-18856980-18857927, MOR258-3
MMRRC Submission 041884-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock # R4618 (G1)
Quality Score 225
Status Validated
Chromosome 4
Chromosomal Location 118687486-118692756 bp(-) (GRCm38)
Type of Mutation utr 3 prime
DNA Base Change (assembly) A to T at 118689470 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000149966 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060562] [ENSMUST00000060562] [ENSMUST00000216226]
AlphaFold Q8VFY3
Predicted Effect probably benign
Transcript: ENSMUST00000060562
SMART Domains Protein: ENSMUSP00000053925
Gene: ENSMUSG00000043383

DomainStartEndE-ValueType
low complexity region 10 24 N/A INTRINSIC
Pfam:7tm_4 34 311 1.5e-55 PFAM
Pfam:7TM_GPCR_Srsx 38 243 1.6e-5 PFAM
Pfam:7tm_1 44 293 4.2e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000060562
SMART Domains Protein: ENSMUSP00000053925
Gene: ENSMUSG00000043383

DomainStartEndE-ValueType
low complexity region 10 24 N/A INTRINSIC
Pfam:7tm_4 34 311 1.5e-55 PFAM
Pfam:7TM_GPCR_Srsx 38 243 1.6e-5 PFAM
Pfam:7tm_1 44 293 4.2e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000216226
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 98% (89/91)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930432M17Rik A T 3: 121,679,446 K83N unknown Het
Adamtsl3 T A 7: 82,606,520 M1580K probably benign Het
Adprhl1 A G 8: 13,242,250 probably null Het
Akap3 G T 6: 126,866,443 C675F probably benign Het
Asap1 A T 15: 64,152,895 H318Q probably damaging Het
Atf7ip G T 6: 136,565,106 A18S probably damaging Het
Bcl2a1a A C 9: 88,957,304 N85T probably damaging Het
Btnl6 G A 17: 34,514,146 P248S probably damaging Het
C9 A G 15: 6,491,463 D51G probably damaging Het
Ccdc14 T A 16: 34,706,495 C257S probably benign Het
Cd5l A G 3: 87,368,619 T299A probably benign Het
Endou C T 15: 97,713,882 V292M possibly damaging Het
Fbxo36 T C 1: 84,900,028 I137T probably damaging Het
Fcer1a T C 1: 173,222,641 I161V possibly damaging Het
Fsip2 A G 2: 82,987,759 Y4612C probably benign Het
Gcnt2 T A 13: 40,958,194 L353* probably null Het
Ghrhr T C 6: 55,381,754 F172S probably damaging Het
Gins1 T A 2: 150,917,861 probably null Het
Gm16519 T G 17: 70,929,242 L62R probably damaging Het
Gm4758 T A 16: 36,312,590 D76E possibly damaging Het
Gpr20 T C 15: 73,695,736 N268S probably benign Het
Greb1l A G 18: 10,498,965 T283A probably benign Het
Grin2c T A 11: 115,252,747 D729V probably damaging Het
Heatr4 T G 12: 83,978,067 T327P probably damaging Het
Hes2 A C 4: 152,160,388 S105R probably benign Het
Hsph1 A G 5: 149,618,843 V705A probably benign Het
Ighv1-82 T C 12: 115,952,660 T77A probably benign Het
Itih1 A T 14: 30,929,831 D851E probably benign Het
Klhdc7b A G 15: 89,387,269 T785A probably benign Het
Lmbr1 G T 5: 29,346,865 A74E probably damaging Het
Lonp1 A C 17: 56,622,511 H175Q probably benign Het
Maml2 T C 9: 13,620,075 F195S probably damaging Het
Man2b2 G T 5: 36,817,639 T436K probably benign Het
Man2c1 T C 9: 57,142,155 probably null Het
Mettl11b A T 1: 163,725,028 F10I probably damaging Het
Mrps15 G A 4: 126,047,044 probably benign Het
Mtrf1l C A 10: 5,817,586 V177F probably benign Het
Naxd A T 8: 11,509,489 I213F probably damaging Het
Nbeal1 T A 1: 60,228,731 probably benign Het
Nfatc1 T C 18: 80,697,832 I318V probably damaging Het
Nid2 T A 14: 19,808,010 I1297N probably damaging Het
Nol10 T C 12: 17,348,561 V3A probably damaging Het
Nop14 G T 5: 34,639,218 P765Q probably damaging Het
Noxa1 C T 2: 25,091,749 G114D probably damaging Het
Olfr1100 A G 2: 86,978,274 I174T possibly damaging Het
Olfr714 G A 7: 107,074,554 C242Y probably damaging Het
Olfr73 A G 2: 88,034,554 V195A probably benign Het
Opa1 T C 16: 29,587,039 W141R probably damaging Het
Pde4d A T 13: 109,933,877 M7L probably benign Het
Phykpl G A 11: 51,592,229 A188T probably damaging Het
Pkd2l1 C A 19: 44,154,134 A490S probably damaging Het
Pkhd1l1 T A 15: 44,539,682 V2260D probably damaging Het
Ptprt T C 2: 161,553,845 E1136G probably damaging Het
Rad21 A T 15: 51,970,024 L353Q probably damaging Het
Rfx4 G T 10: 84,880,896 A425S probably benign Het
Rnf38 A G 4: 44,142,450 S169P probably damaging Het
Samd9l C A 6: 3,376,347 V305F probably damaging Het
Serpini1 A G 3: 75,616,576 K164E probably benign Het
Sirt6 A G 10: 81,626,574 L37P probably damaging Het
Sorbs1 T C 19: 40,373,518 T141A probably damaging Het
Tacc2 A T 7: 130,626,216 T1563S probably benign Het
Tbc1d14 A C 5: 36,530,381 probably benign Het
Tbrg4 G A 11: 6,620,185 probably benign Het
Tox2 T C 2: 163,320,647 L479P probably damaging Het
Tpp1 A T 7: 105,751,706 L38Q probably benign Het
Trhr A G 15: 44,197,641 N186D probably benign Het
Trmt1l C T 1: 151,454,048 Q581* probably null Het
Tsen54 T A 11: 115,815,421 probably benign Het
Tsg101 A G 7: 46,892,509 I138T possibly damaging Het
Usp22 A G 11: 61,161,443 S237P probably damaging Het
Vmn1r209 A G 13: 22,806,449 S24P possibly damaging Het
Vmn2r18 A T 5: 151,584,959 H233Q possibly damaging Het
Vmn2r45 A T 7: 8,483,437 I284N probably benign Het
Vmn2r66 T C 7: 84,995,088 I705V possibly damaging Het
Vsig1 G T X: 140,926,386 A95S probably benign Het
Zdhhc11 T A 13: 73,979,230 M242K probably benign Het
Zfp352 A G 4: 90,225,081 K486R probably benign Het
Other mutations in Olfr1342
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01823:Olfr1342 APN 4 118689721 missense probably damaging 1.00
IGL02391:Olfr1342 APN 4 118690341 missense probably damaging 1.00
R0648:Olfr1342 UTSW 4 118690072 missense probably benign
R1565:Olfr1342 UTSW 4 118690192 missense probably damaging 1.00
R1675:Olfr1342 UTSW 4 118689948 missense probably benign 0.00
R1823:Olfr1342 UTSW 4 118690192 missense probably damaging 1.00
R2343:Olfr1342 UTSW 4 118690187 missense probably benign 0.30
R4941:Olfr1342 UTSW 4 118689892 missense possibly damaging 0.76
R5408:Olfr1342 UTSW 4 118690444 missense probably benign 0.00
R5587:Olfr1342 UTSW 4 118689870 missense probably damaging 1.00
R5895:Olfr1342 UTSW 4 118690117 missense probably damaging 0.97
R6023:Olfr1342 UTSW 4 118690074 missense probably damaging 1.00
R6307:Olfr1342 UTSW 4 118689948 missense probably benign 0.00
R6324:Olfr1342 UTSW 4 118690531 start gained probably benign
R6890:Olfr1342 UTSW 4 118689531 missense possibly damaging 0.72
R7218:Olfr1342 UTSW 4 118690018 missense probably benign
R7408:Olfr1342 UTSW 4 118689662 missense probably damaging 0.98
R7555:Olfr1342 UTSW 4 118689642 missense possibly damaging 0.94
R7749:Olfr1342 UTSW 4 118690228 missense probably damaging 1.00
R8098:Olfr1342 UTSW 4 118690209 missense possibly damaging 0.88
R8493:Olfr1342 UTSW 4 118690032 missense probably benign 0.01
Z1176:Olfr1342 UTSW 4 118690272 missense probably benign 0.31
Predicted Primers PCR Primer
(F):5'- AGCCCATGGAAAGCAATCAATG -3'
(R):5'- GCCAGCCATGATCATGTACATG -3'

Sequencing Primer
(F):5'- GCCCATGGAAAGCAATCAATGTCTAC -3'
(R):5'- CGGTTCTTGGTATGACCCAGAAC -3'
Posted On 2015-09-25