Incidental Mutation 'R4618:Bcl2a1a'
ID345107
Institutional Source Beutler Lab
Gene Symbol Bcl2a1a
Ensembl Gene ENSMUSG00000102037
Gene NameB cell leukemia/lymphoma 2 related protein A1a
SynonymsA1, Hbpa1, Bcl2a1, Bfl-1
MMRRC Submission 041884-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.156) question?
Stock #R4618 (G1)
Quality Score221
Status Validated
Chromosome9
Chromosomal Location88956900-88962419 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 88957304 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Threonine at position 85 (N85T)
Ref Sequence ENSEMBL: ENSMUSP00000096086 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098485]
PDB Structure
STRUCTURE OF MOUSE A1 BOUND TO THE PUMA BH3-DOMAIN [X-RAY DIFFRACTION]
STRUCTURE OF MOUSE A1 BOUND TO THE BMF BH3-DOMAIN [X-RAY DIFFRACTION]
STRUCTURE OF MOUSE A1 BOUND TO THE BAK BH3-DOMAIN [X-RAY DIFFRACTION]
STRUCTURE OF MOUSE A1 BOUND TO THE BID BH3-DOMAIN [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000098485
AA Change: N85T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000096086
Gene: ENSMUSG00000102037
AA Change: N85T

DomainStartEndE-ValueType
BCL 37 140 2.45e-41 SMART
Meta Mutation Damage Score 0.5216 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 98% (89/91)
MGI Phenotype PHENOTYPE: Homozygous null mutants show enhanced spontaneous apoptosis of neutrophils, while both heterozygous and homozygous null mutants lack LPS-induced neutrophil apoptosis inhibition. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930432M17Rik A T 3: 121,679,446 K83N unknown Het
Adamtsl3 T A 7: 82,606,520 M1580K probably benign Het
Adprhl1 A G 8: 13,242,250 probably null Het
Akap3 G T 6: 126,866,443 C675F probably benign Het
Asap1 A T 15: 64,152,895 H318Q probably damaging Het
Atf7ip G T 6: 136,565,106 A18S probably damaging Het
Btnl6 G A 17: 34,514,146 P248S probably damaging Het
C9 A G 15: 6,491,463 D51G probably damaging Het
Ccdc14 T A 16: 34,706,495 C257S probably benign Het
Cd5l A G 3: 87,368,619 T299A probably benign Het
Endou C T 15: 97,713,882 V292M possibly damaging Het
Fbxo36 T C 1: 84,900,028 I137T probably damaging Het
Fcer1a T C 1: 173,222,641 I161V possibly damaging Het
Fsip2 A G 2: 82,987,759 Y4612C probably benign Het
Gcnt2 T A 13: 40,958,194 L353* probably null Het
Ghrhr T C 6: 55,381,754 F172S probably damaging Het
Gins1 T A 2: 150,917,861 probably null Het
Gm16519 T G 17: 70,929,242 L62R probably damaging Het
Gm4758 T A 16: 36,312,590 D76E possibly damaging Het
Gpr20 T C 15: 73,695,736 N268S probably benign Het
Greb1l A G 18: 10,498,965 T283A probably benign Het
Grin2c T A 11: 115,252,747 D729V probably damaging Het
Heatr4 T G 12: 83,978,067 T327P probably damaging Het
Hes2 A C 4: 152,160,388 S105R probably benign Het
Hsph1 A G 5: 149,618,843 V705A probably benign Het
Ighv1-82 T C 12: 115,952,660 T77A probably benign Het
Itih1 A T 14: 30,929,831 D851E probably benign Het
Klhdc7b A G 15: 89,387,269 T785A probably benign Het
Lmbr1 G T 5: 29,346,865 A74E probably damaging Het
Lonp1 A C 17: 56,622,511 H175Q probably benign Het
Maml2 T C 9: 13,620,075 F195S probably damaging Het
Man2b2 G T 5: 36,817,639 T436K probably benign Het
Man2c1 T C 9: 57,142,155 probably null Het
Mettl11b A T 1: 163,725,028 F10I probably damaging Het
Mrps15 G A 4: 126,047,044 probably benign Het
Mtrf1l C A 10: 5,817,586 V177F probably benign Het
Naxd A T 8: 11,509,489 I213F probably damaging Het
Nbeal1 T A 1: 60,228,731 probably benign Het
Nfatc1 T C 18: 80,697,832 I318V probably damaging Het
Nid2 T A 14: 19,808,010 I1297N probably damaging Het
Nol10 T C 12: 17,348,561 V3A probably damaging Het
Nop14 G T 5: 34,639,218 P765Q probably damaging Het
Noxa1 C T 2: 25,091,749 G114D probably damaging Het
Olfr1100 A G 2: 86,978,274 I174T possibly damaging Het
Olfr1342 A T 4: 118,689,470 probably benign Het
Olfr714 G A 7: 107,074,554 C242Y probably damaging Het
Olfr73 A G 2: 88,034,554 V195A probably benign Het
Opa1 T C 16: 29,587,039 W141R probably damaging Het
Pde4d A T 13: 109,933,877 M7L probably benign Het
Phykpl G A 11: 51,592,229 A188T probably damaging Het
Pkd2l1 C A 19: 44,154,134 A490S probably damaging Het
Pkhd1l1 T A 15: 44,539,682 V2260D probably damaging Het
Ptprt T C 2: 161,553,845 E1136G probably damaging Het
Rad21 A T 15: 51,970,024 L353Q probably damaging Het
Rfx4 G T 10: 84,880,896 A425S probably benign Het
Rnf38 A G 4: 44,142,450 S169P probably damaging Het
Samd9l C A 6: 3,376,347 V305F probably damaging Het
Serpini1 A G 3: 75,616,576 K164E probably benign Het
Sirt6 A G 10: 81,626,574 L37P probably damaging Het
Sorbs1 T C 19: 40,373,518 T141A probably damaging Het
Tacc2 A T 7: 130,626,216 T1563S probably benign Het
Tbc1d14 A C 5: 36,530,381 probably benign Het
Tbrg4 G A 11: 6,620,185 probably benign Het
Tox2 T C 2: 163,320,647 L479P probably damaging Het
Tpp1 A T 7: 105,751,706 L38Q probably benign Het
Trhr A G 15: 44,197,641 N186D probably benign Het
Trmt1l C T 1: 151,454,048 Q581* probably null Het
Tsen54 T A 11: 115,815,421 probably benign Het
Tsg101 A G 7: 46,892,509 I138T possibly damaging Het
Usp22 A G 11: 61,161,443 S237P probably damaging Het
Vmn1r209 A G 13: 22,806,449 S24P possibly damaging Het
Vmn2r18 A T 5: 151,584,959 H233Q possibly damaging Het
Vmn2r45 A T 7: 8,483,437 I284N probably benign Het
Vmn2r66 T C 7: 84,995,088 I705V possibly damaging Het
Vsig1 G T X: 140,926,386 A95S probably benign Het
Zdhhc11 T A 13: 73,979,230 M242K probably benign Het
Zfp352 A G 4: 90,225,081 K486R probably benign Het
Other mutations in Bcl2a1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01368:Bcl2a1a APN 9 88957447 missense probably damaging 1.00
IGL02942:Bcl2a1a APN 9 88957042 utr 5 prime probably benign
R0064:Bcl2a1a UTSW 9 88957463 missense probably damaging 1.00
R1672:Bcl2a1a UTSW 9 88957450 missense probably damaging 1.00
R2511:Bcl2a1a UTSW 9 88957453 missense probably damaging 1.00
R4616:Bcl2a1a UTSW 9 88957453 missense probably damaging 1.00
R4947:Bcl2a1a UTSW 9 88957282 missense probably damaging 1.00
R7584:Bcl2a1a UTSW 9 88957292 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCAAGCCAAGCATGCAGAG -3'
(R):5'- GGCATACAAACAGACTGAAGTC -3'

Sequencing Primer
(F):5'- GCAGAGTGCTACAAAGAGTTGCTTTC -3'
(R):5'- GCATACAAACAGACTGAAGTCCTTTG -3'
Posted On2015-09-25