Incidental Mutation 'R0103:Tnfrsf21'
ID34511
Institutional Source Beutler Lab
Gene Symbol Tnfrsf21
Ensembl Gene ENSMUSG00000023915
Gene Nametumor necrosis factor receptor superfamily, member 21
SynonymsDR6, TR7, Death receptor 6
MMRRC Submission 038389-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.098) question?
Stock #R0103 (G1)
Quality Score225
Status Validated (trace)
Chromosome17
Chromosomal Location43016555-43089188 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 43038213 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Tyrosine at position 239 (H239Y)
Ref Sequence ENSEMBL: ENSMUSP00000024708 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024708]
Predicted Effect probably benign
Transcript: ENSMUST00000024708
AA Change: H239Y

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000024708
Gene: ENSMUSG00000023915
AA Change: H239Y

DomainStartEndE-ValueType
TNFR 50 88 1.58e1 SMART
TNFR 91 131 3.42e-3 SMART
TNFR 133 168 9.31e-5 SMART
TNFR 171 211 1.1e-1 SMART
transmembrane domain 351 370 N/A INTRINSIC
DEATH 393 498 1.41e-22 SMART
low complexity region 511 526 N/A INTRINSIC
low complexity region 562 575 N/A INTRINSIC
PDB:2DBH|A 576 655 5e-48 PDB
Meta Mutation Damage Score 0.0680 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.8%
Validation Efficiency 99% (84/85)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the tumor necrosis factor receptor superfamily. The encoded protein activates nuclear factor kappa-B and mitogen-activated protein kinase 8 (also called c-Jun N-terminal kinase 1), and induces cell apoptosis. Through its death domain, the encoded receptor interacts with tumor necrosis factor receptor type 1-associated death domain (TRADD) protein, which is known to mediate signal transduction of tumor necrosis factor receptors. Knockout studies in mice suggest that this gene plays a role in T-helper cell activation, and may be involved in inflammation and immune regulation. [provided by RefSeq, Jul 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired T cell differentiation and an enhanced Th2 response. Mice homozygous for a different knock-out allele show increased CD4+ T cell proliferation and Th2 cytokine production, and enhanced B cell proliferation, survival, and humoral responses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A C 11: 9,273,951 R443S probably damaging Het
Anapc1 T C 2: 128,680,452 probably benign Het
Aqr T A 2: 114,149,016 I313F probably damaging Het
Arfgap3 A T 15: 83,322,721 probably benign Het
Asah2 G T 19: 32,018,977 H374N probably benign Het
Avl9 G T 6: 56,736,483 R242L probably benign Het
Ccdc106 C A 7: 5,057,545 Q35K probably benign Het
Ccm2l G T 2: 153,067,919 E64* probably null Het
Cep85l A T 10: 53,278,174 D776E possibly damaging Het
Cfap52 T A 11: 67,925,125 I611F possibly damaging Het
Cldn22 C T 8: 47,824,554 T9M probably benign Het
Coa7 T C 4: 108,338,141 L89P possibly damaging Het
Cox7a2l A T 17: 83,514,272 Y2N probably damaging Het
Ctns A C 11: 73,185,311 I299M probably damaging Het
Cyp27a1 A C 1: 74,735,915 E301A probably benign Het
Cyp2b13 A T 7: 26,088,710 K421M probably damaging Het
Cyp4f40 G T 17: 32,676,308 C468F probably damaging Het
Cyp4f40 C A 17: 32,676,309 C468* probably null Het
Dcun1d5 G A 9: 7,188,788 C74Y probably damaging Het
Dennd4c A G 4: 86,812,446 Y860C probably benign Het
Dgkz T C 2: 91,934,205 T1028A probably benign Het
Dhx58 T C 11: 100,695,270 T642A probably damaging Het
Dlg4 A G 11: 70,031,193 Y87C probably damaging Het
Dnah6 C T 6: 73,092,172 E2511K probably damaging Het
Entpd5 C A 12: 84,396,943 E9* probably null Het
Fbln2 A C 6: 91,271,550 I1066L probably benign Het
Fhl2 C T 1: 43,153,221 R4H probably benign Het
Frmpd1 T A 4: 45,229,884 I17K probably damaging Het
Gbp7 T A 3: 142,546,538 N627K probably benign Het
Gm20388 A G 8: 122,269,733 probably benign Het
Gnptab A G 10: 88,429,519 Y331C probably damaging Het
Hdac4 T C 1: 91,975,644 E521G possibly damaging Het
Hibadh T A 6: 52,557,877 M173L probably benign Het
Iba57 C T 11: 59,163,613 A27T probably benign Het
Itga1 T C 13: 115,016,254 I211V probably benign Het
Keg1 A T 19: 12,718,916 I155F possibly damaging Het
Krt84 T C 15: 101,530,236 E272G probably damaging Het
Lrp2 C A 2: 69,477,040 V2892L probably benign Het
Ltb A G 17: 35,195,040 probably benign Het
Masp1 G A 16: 23,458,018 P579L probably damaging Het
Mtor T A 4: 148,533,902 M1724K probably benign Het
Myo3a T G 2: 22,544,322 probably benign Het
Myo9b C T 8: 71,323,849 probably benign Het
Ncor1 G T 11: 62,343,045 Q444K possibly damaging Het
Nek7 A T 1: 138,544,242 C53* probably null Het
Obscn G T 11: 59,062,696 Y4044* probably null Het
Olfr1458 G A 19: 13,103,278 R3C possibly damaging Het
Pcdh15 A T 10: 74,210,425 D178V probably damaging Het
Pcsk6 T C 7: 65,929,097 probably benign Het
Phxr4 T C 9: 13,431,791 probably benign Het
Pkhd1 T A 1: 20,523,359 D1510V probably benign Het
Pkhd1l1 T C 15: 44,597,141 C4249R probably benign Het
Plxnb2 A G 15: 89,161,769 Y968H possibly damaging Het
Prpf39 T C 12: 65,055,283 V378A possibly damaging Het
Psd2 A G 18: 36,004,717 N455S probably damaging Het
Ptch2 C A 4: 117,109,425 probably benign Het
Rab4b A G 7: 27,174,502 I117T probably benign Het
Rad9b A T 5: 122,331,527 V348E probably damaging Het
Rcor1 T C 12: 111,109,778 probably benign Het
Rhoc A T 3: 104,791,991 E32V possibly damaging Het
Rnf40 T G 7: 127,600,571 V925G probably damaging Het
Rptor G T 11: 119,884,967 R988L probably benign Het
Slc25a32 A T 15: 39,099,897 Y176* probably null Het
Slc7a1 T A 5: 148,352,426 K4* probably null Het
Ss18 A C 18: 14,679,421 Y38D probably damaging Het
Syt4 T A 18: 31,447,220 probably benign Het
Taar4 A T 10: 23,961,406 N305Y probably damaging Het
Taar7b A T 10: 24,000,294 Y119F probably benign Het
Tcaf1 G T 6: 42,686,390 D185E probably benign Het
Tmem138 T C 19: 10,574,952 N62S possibly damaging Het
Tnfaip2 C T 12: 111,445,810 T215M probably benign Het
Tnfrsf25 C T 4: 152,116,948 P65S possibly damaging Het
Trp53bp1 A T 2: 121,236,759 S495R possibly damaging Het
Trpv3 T C 11: 73,293,979 F597S probably damaging Het
Tsc22d4 A C 5: 137,747,116 M1L possibly damaging Het
Ttc39a A G 4: 109,421,453 probably null Het
Ttn T G 2: 76,761,226 H21033P probably damaging Het
Ugt2a3 A G 5: 87,336,718 V149A possibly damaging Het
Ush2a T G 1: 188,319,070 I251R possibly damaging Het
Vamp4 T C 1: 162,589,539 C114R possibly damaging Het
Wdr33 T C 18: 31,833,335 V135A probably damaging Het
Zc3h13 T A 14: 75,330,468 V1067E probably damaging Het
Zcwpw1 G A 5: 137,810,113 W274* probably null Het
Zfp219 T A 14: 52,006,706 H627L probably damaging Het
Other mutations in Tnfrsf21
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01406:Tnfrsf21 APN 17 43037946 missense probably damaging 1.00
IGL01663:Tnfrsf21 APN 17 43087811 missense probably benign 0.13
IGL01811:Tnfrsf21 APN 17 43037613 missense probably benign
IGL01916:Tnfrsf21 APN 17 43039803 missense probably benign 0.00
IGL01934:Tnfrsf21 APN 17 43065187 missense probably benign 0.15
IGL02184:Tnfrsf21 APN 17 43085463 missense probably benign 0.37
IGL02292:Tnfrsf21 APN 17 43039911 missense probably benign
IGL02385:Tnfrsf21 APN 17 43040051 missense probably damaging 1.00
IGL02710:Tnfrsf21 APN 17 43087929 missense probably damaging 0.97
IGL03001:Tnfrsf21 APN 17 43087895 missense probably damaging 0.99
IGL03003:Tnfrsf21 APN 17 43039943 missense probably damaging 1.00
palmer_park UTSW 17 43038010 missense probably damaging 1.00
PIT4480001:Tnfrsf21 UTSW 17 43037911 missense probably benign 0.00
R0007:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0046:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0088:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0091:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0102:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0102:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0105:Tnfrsf21 UTSW 17 43040191 critical splice donor site probably null
R0105:Tnfrsf21 UTSW 17 43040191 critical splice donor site probably null
R0206:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0211:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0240:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0243:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0308:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0363:Tnfrsf21 UTSW 17 43037877 missense probably benign 0.01
R0456:Tnfrsf21 UTSW 17 43038091 missense probably benign 0.01
R0522:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0523:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0525:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0528:Tnfrsf21 UTSW 17 43037614 missense probably benign
R0543:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0549:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0550:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0699:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0724:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0734:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0847:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0880:Tnfrsf21 UTSW 17 43037842 nonsense probably null
R1591:Tnfrsf21 UTSW 17 43085374 missense probably benign 0.01
R2069:Tnfrsf21 UTSW 17 43037938 missense possibly damaging 0.67
R2153:Tnfrsf21 UTSW 17 43087872 missense probably damaging 1.00
R2323:Tnfrsf21 UTSW 17 43085529 nonsense probably null
R3941:Tnfrsf21 UTSW 17 43038010 missense probably damaging 1.00
R4438:Tnfrsf21 UTSW 17 43087842 missense possibly damaging 0.49
R4509:Tnfrsf21 UTSW 17 43085388 missense probably benign 0.00
R4510:Tnfrsf21 UTSW 17 43065019 missense probably damaging 0.98
R4511:Tnfrsf21 UTSW 17 43065019 missense probably damaging 0.98
R4708:Tnfrsf21 UTSW 17 43038232 missense possibly damaging 0.66
R4721:Tnfrsf21 UTSW 17 43085504 missense probably damaging 1.00
R4811:Tnfrsf21 UTSW 17 43037730 missense probably benign 0.00
R5437:Tnfrsf21 UTSW 17 43037862 missense possibly damaging 0.55
R5767:Tnfrsf21 UTSW 17 43037659 missense probably damaging 0.98
R6057:Tnfrsf21 UTSW 17 43039715 missense possibly damaging 0.86
R6392:Tnfrsf21 UTSW 17 43017088 missense probably benign 0.00
R6860:Tnfrsf21 UTSW 17 43017066 missense probably benign
R7253:Tnfrsf21 UTSW 17 43037667 missense probably benign 0.00
R7288:Tnfrsf21 UTSW 17 43037818 missense possibly damaging 0.86
R7643:Tnfrsf21 UTSW 17 43037916 missense probably benign 0.00
R7937:Tnfrsf21 UTSW 17 43037925 missense probably benign 0.01
R8098:Tnfrsf21 UTSW 17 43039899 missense probably benign
V3553:Tnfrsf21 UTSW 17 43037931 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGAAGTGTAAAGCTCACACGGACTG -3'
(R):5'- GCTCCATCTACACACGATTAGCTCC -3'

Sequencing Primer
(F):5'- GGACTGTCTGGGTCAGAAC -3'
(R):5'- acaactaaaatcactcaactcactc -3'
Posted On2013-05-09