Incidental Mutation 'R4618:Gcnt2'
ID345121
Institutional Source Beutler Lab
Gene Symbol Gcnt2
Ensembl Gene ENSMUSG00000021360
Gene Nameglucosaminyl (N-acetyl) transferase 2, I-branching enzyme
SynonymsIGnTB, IGnT, IGnTA, IGnTC, 5330430K10Rik
MMRRC Submission 041884-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.106) question?
Stock #R4618 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location40859754-40960892 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 40958194 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Stop codon at position 353 (L353*)
Ref Sequence ENSEMBL: ENSMUSP00000105820 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067778] [ENSMUST00000069958] [ENSMUST00000110191] [ENSMUST00000223570] [ENSMUST00000225759]
Predicted Effect probably null
Transcript: ENSMUST00000067778
AA Change: L353*
SMART Domains Protein: ENSMUSP00000066467
Gene: ENSMUSG00000021360
AA Change: L353*

DomainStartEndE-ValueType
transmembrane domain 7 26 N/A INTRINSIC
Pfam:Branch 95 357 4.2e-58 PFAM
low complexity region 377 386 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000069958
AA Change: L353*
SMART Domains Protein: ENSMUSP00000070942
Gene: ENSMUSG00000021360
AA Change: L353*

DomainStartEndE-ValueType
low complexity region 8 21 N/A INTRINSIC
Pfam:Branch 95 357 8.4e-60 PFAM
low complexity region 377 386 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000110191
AA Change: L353*
SMART Domains Protein: ENSMUSP00000105820
Gene: ENSMUSG00000021360
AA Change: L353*

DomainStartEndE-ValueType
transmembrane domain 7 24 N/A INTRINSIC
Pfam:Branch 95 357 5.2e-61 PFAM
low complexity region 377 386 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153685
Predicted Effect probably benign
Transcript: ENSMUST00000223570
Predicted Effect probably benign
Transcript: ENSMUST00000225759
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225996
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 98% (89/91)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the enzyme responsible for formation of the blood group I antigen. The i and I antigens are distinguished by linear and branched poly-N-acetyllactosaminoglycans, respectively. The encoded protein is the I-branching enzyme, a beta-1,6-N-acetylglucosaminyltransferase responsible for the conversion of fetal i antigen to adult I antigen in erythrocytes during embryonic development. Mutations in this gene have been associated with adult i blood group phenotype. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele show hypoactivity, a reduced B cell number, epidermoid cyst formation in male abdominal skin, and impaired renal function with increased blood urea nitrogen and creatinine levels and vacuolization of renal tubular epithelial cells in aging mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930432M17Rik A T 3: 121,679,446 K83N unknown Het
Adamtsl3 T A 7: 82,606,520 M1580K probably benign Het
Adprhl1 A G 8: 13,242,250 probably null Het
Akap3 G T 6: 126,866,443 C675F probably benign Het
Asap1 A T 15: 64,152,895 H318Q probably damaging Het
Atf7ip G T 6: 136,565,106 A18S probably damaging Het
Bcl2a1a A C 9: 88,957,304 N85T probably damaging Het
Btnl6 G A 17: 34,514,146 P248S probably damaging Het
C9 A G 15: 6,491,463 D51G probably damaging Het
Ccdc14 T A 16: 34,706,495 C257S probably benign Het
Cd5l A G 3: 87,368,619 T299A probably benign Het
Endou C T 15: 97,713,882 V292M possibly damaging Het
Fbxo36 T C 1: 84,900,028 I137T probably damaging Het
Fcer1a T C 1: 173,222,641 I161V possibly damaging Het
Fsip2 A G 2: 82,987,759 Y4612C probably benign Het
Ghrhr T C 6: 55,381,754 F172S probably damaging Het
Gins1 T A 2: 150,917,861 probably null Het
Gm16519 T G 17: 70,929,242 L62R probably damaging Het
Gm4758 T A 16: 36,312,590 D76E possibly damaging Het
Gpr20 T C 15: 73,695,736 N268S probably benign Het
Greb1l A G 18: 10,498,965 T283A probably benign Het
Grin2c T A 11: 115,252,747 D729V probably damaging Het
Heatr4 T G 12: 83,978,067 T327P probably damaging Het
Hes2 A C 4: 152,160,388 S105R probably benign Het
Hsph1 A G 5: 149,618,843 V705A probably benign Het
Ighv1-82 T C 12: 115,952,660 T77A probably benign Het
Itih1 A T 14: 30,929,831 D851E probably benign Het
Klhdc7b A G 15: 89,387,269 T785A probably benign Het
Lmbr1 G T 5: 29,346,865 A74E probably damaging Het
Lonp1 A C 17: 56,622,511 H175Q probably benign Het
Maml2 T C 9: 13,620,075 F195S probably damaging Het
Man2b2 G T 5: 36,817,639 T436K probably benign Het
Man2c1 T C 9: 57,142,155 probably null Het
Mettl11b A T 1: 163,725,028 F10I probably damaging Het
Mrps15 G A 4: 126,047,044 probably benign Het
Mtrf1l C A 10: 5,817,586 V177F probably benign Het
Naxd A T 8: 11,509,489 I213F probably damaging Het
Nbeal1 T A 1: 60,228,731 probably benign Het
Nfatc1 T C 18: 80,697,832 I318V probably damaging Het
Nid2 T A 14: 19,808,010 I1297N probably damaging Het
Nol10 T C 12: 17,348,561 V3A probably damaging Het
Nop14 G T 5: 34,639,218 P765Q probably damaging Het
Noxa1 C T 2: 25,091,749 G114D probably damaging Het
Olfr1100 A G 2: 86,978,274 I174T possibly damaging Het
Olfr1342 A T 4: 118,689,470 probably benign Het
Olfr714 G A 7: 107,074,554 C242Y probably damaging Het
Olfr73 A G 2: 88,034,554 V195A probably benign Het
Opa1 T C 16: 29,587,039 W141R probably damaging Het
Pde4d A T 13: 109,933,877 M7L probably benign Het
Phykpl G A 11: 51,592,229 A188T probably damaging Het
Pkd2l1 C A 19: 44,154,134 A490S probably damaging Het
Pkhd1l1 T A 15: 44,539,682 V2260D probably damaging Het
Ptprt T C 2: 161,553,845 E1136G probably damaging Het
Rad21 A T 15: 51,970,024 L353Q probably damaging Het
Rfx4 G T 10: 84,880,896 A425S probably benign Het
Rnf38 A G 4: 44,142,450 S169P probably damaging Het
Samd9l C A 6: 3,376,347 V305F probably damaging Het
Serpini1 A G 3: 75,616,576 K164E probably benign Het
Sirt6 A G 10: 81,626,574 L37P probably damaging Het
Sorbs1 T C 19: 40,373,518 T141A probably damaging Het
Tacc2 A T 7: 130,626,216 T1563S probably benign Het
Tbc1d14 A C 5: 36,530,381 probably benign Het
Tbrg4 G A 11: 6,620,185 probably benign Het
Tox2 T C 2: 163,320,647 L479P probably damaging Het
Tpp1 A T 7: 105,751,706 L38Q probably benign Het
Trhr A G 15: 44,197,641 N186D probably benign Het
Trmt1l C T 1: 151,454,048 Q581* probably null Het
Tsen54 T A 11: 115,815,421 probably benign Het
Tsg101 A G 7: 46,892,509 I138T possibly damaging Het
Usp22 A G 11: 61,161,443 S237P probably damaging Het
Vmn1r209 A G 13: 22,806,449 S24P possibly damaging Het
Vmn2r18 A T 5: 151,584,959 H233Q possibly damaging Het
Vmn2r45 A T 7: 8,483,437 I284N probably benign Het
Vmn2r66 T C 7: 84,995,088 I705V possibly damaging Het
Vsig1 G T X: 140,926,386 A95S probably benign Het
Zdhhc11 T A 13: 73,979,230 M242K probably benign Het
Zfp352 A G 4: 90,225,081 K486R probably benign Het
Other mutations in Gcnt2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01523:Gcnt2 APN 13 40887863 missense probably benign 0.06
IGL01693:Gcnt2 APN 13 40888073 missense probably benign
IGL02506:Gcnt2 APN 13 40887380 missense probably benign 0.02
IGL03184:Gcnt2 APN 13 40888184 missense probably benign 0.01
BB001:Gcnt2 UTSW 13 40918564 nonsense probably null
BB011:Gcnt2 UTSW 13 40918564 nonsense probably null
PIT4472001:Gcnt2 UTSW 13 40917937 missense probably benign 0.39
R0358:Gcnt2 UTSW 13 40860853 missense probably damaging 0.99
R0734:Gcnt2 UTSW 13 40860521 missense probably benign 0.00
R1863:Gcnt2 UTSW 13 40861101 missense possibly damaging 0.95
R3103:Gcnt2 UTSW 13 40918606 missense probably benign 0.00
R3156:Gcnt2 UTSW 13 40861178 missense probably benign 0.36
R3893:Gcnt2 UTSW 13 40860446 missense probably benign 0.14
R4134:Gcnt2 UTSW 13 40887807 missense probably damaging 1.00
R4135:Gcnt2 UTSW 13 40887807 missense probably damaging 1.00
R4279:Gcnt2 UTSW 13 40888190 missense probably benign 0.17
R4422:Gcnt2 UTSW 13 40860525 nonsense probably null
R4599:Gcnt2 UTSW 13 40887490 missense probably benign
R4908:Gcnt2 UTSW 13 40860734 missense probably damaging 1.00
R5123:Gcnt2 UTSW 13 40918355 missense probably damaging 0.99
R5291:Gcnt2 UTSW 13 40918792 missense probably damaging 1.00
R5437:Gcnt2 UTSW 13 40861176 missense probably damaging 1.00
R5463:Gcnt2 UTSW 13 40918174 missense possibly damaging 0.80
R5471:Gcnt2 UTSW 13 40860719 missense probably damaging 1.00
R5472:Gcnt2 UTSW 13 40953579 missense probably benign 0.30
R5493:Gcnt2 UTSW 13 40953600 missense possibly damaging 0.70
R5586:Gcnt2 UTSW 13 40860953 missense probably damaging 1.00
R5695:Gcnt2 UTSW 13 40918199 missense probably benign 0.03
R6244:Gcnt2 UTSW 13 40861241 missense probably damaging 1.00
R6293:Gcnt2 UTSW 13 40918697 missense probably damaging 1.00
R7036:Gcnt2 UTSW 13 40887556 frame shift probably null
R7077:Gcnt2 UTSW 13 40860420 missense probably benign
R7432:Gcnt2 UTSW 13 40887212 intron probably benign
R7474:Gcnt2 UTSW 13 40958257 missense probably damaging 1.00
R7508:Gcnt2 UTSW 13 40887681 missense probably benign 0.02
R7599:Gcnt2 UTSW 13 40860867 nonsense probably null
R7678:Gcnt2 UTSW 13 40953719 missense probably benign 0.01
R7806:Gcnt2 UTSW 13 40918241 missense probably damaging 1.00
R7808:Gcnt2 UTSW 13 40860862 missense possibly damaging 0.81
R7909:Gcnt2 UTSW 13 40860450 missense probably benign 0.00
R7924:Gcnt2 UTSW 13 40918564 nonsense probably null
R8110:Gcnt2 UTSW 13 40917722 start gained probably benign
R8287:Gcnt2 UTSW 13 40860632 missense probably damaging 1.00
Z1088:Gcnt2 UTSW 13 40918639 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGCCATTTGTCCTAAACAGAC -3'
(R):5'- TTCCATTTAGGCCCGAGCTG -3'

Sequencing Primer
(F):5'- AAACAGCCTTGGCTCCTG -3'
(R):5'- TGCTGCGGGTCAGAAATACC -3'
Posted On2015-09-25