Mutagenetix > Incidental Mutation

Incidental Mutation 'R4618:Greb1l'

345141

Institutional Source

Beutler Lab

Gene Symbol

Greb1l

Ensembl Gene

ENSMUSG00000042942

Gene Name

growth regulation by estrogen in breast cancer-like

Synonyms

AK220484, mKIAA4095

MMRRC Submission

041884-MU

Accession Numbers

Genbank: NM_001083628; MGI: 3576497

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R4618 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

10325177-10562934 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 10498965 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 283 (T283A)

Ref Sequence

ENSEMBL: ENSMUSP00000134090 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000048977] [ENSMUST00000172532]

AlphaFold

B9EJV3

Predicted Effect

probably benign
Transcript: ENSMUST00000048977
AA Change: T283A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000049003
Gene: ENSMUSG00000042942
AA Change: T283A

Domain	Start	End	E-Value	Type
Pfam:GREB1	1	1172	N/A	PFAM
Pfam:GREB1	1154	1913	N/A	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000172532
AA Change: T283A

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)

SMART Domains

Protein: ENSMUSP00000134090
Gene: ENSMUSG00000042942
AA Change: T283A

Domain	Start	End	E-Value	Type
low complexity region	83	100	N/A	INTRINSIC
low complexity region	282	301	N/A	INTRINSIC
low complexity region	606	617	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000173356

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000224958

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.2%

Validation Efficiency

98% (89/91)

Allele List at MGI

All alleles(5) : Targeted, other(2) Gene trapped(3)

Other mutations in this stock

Total: 77 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930432M17Rik	A	T	3: 121,679,446	K83N	unknown	Het
Adamtsl3	T	A	7: 82,606,520	M1580K	probably benign	Het
Adprhl1	A	G	8: 13,242,250		probably null	Het
Akap3	G	T	6: 126,866,443	C675F	probably benign	Het
Asap1	A	T	15: 64,152,895	H318Q	probably damaging	Het
Atf7ip	G	T	6: 136,565,106	A18S	probably damaging	Het
Bcl2a1a	A	C	9: 88,957,304	N85T	probably damaging	Het
Btnl6	G	A	17: 34,514,146	P248S	probably damaging	Het
C9	A	G	15: 6,491,463	D51G	probably damaging	Het
Ccdc14	T	A	16: 34,706,495	C257S	probably benign	Het
Cd5l	A	G	3: 87,368,619	T299A	probably benign	Het
Endou	C	T	15: 97,713,882	V292M	possibly damaging	Het
Fbxo36	T	C	1: 84,900,028	I137T	probably damaging	Het
Fcer1a	T	C	1: 173,222,641	I161V	possibly damaging	Het
Fsip2	A	G	2: 82,987,759	Y4612C	probably benign	Het
Gcnt2	T	A	13: 40,958,194	L353*	probably null	Het
Ghrhr	T	C	6: 55,381,754	F172S	probably damaging	Het
Gins1	T	A	2: 150,917,861		probably null	Het
Gm16519	T	G	17: 70,929,242	L62R	probably damaging	Het
Gm4758	T	A	16: 36,312,590	D76E	possibly damaging	Het
Gpr20	T	C	15: 73,695,736	N268S	probably benign	Het
Grin2c	T	A	11: 115,252,747	D729V	probably damaging	Het
Heatr4	T	G	12: 83,978,067	T327P	probably damaging	Het
Hes2	A	C	4: 152,160,388	S105R	probably benign	Het
Hsph1	A	G	5: 149,618,843	V705A	probably benign	Het
Ighv1-82	T	C	12: 115,952,660	T77A	probably benign	Het
Itih1	A	T	14: 30,929,831	D851E	probably benign	Het
Klhdc7b	A	G	15: 89,387,269	T785A	probably benign	Het
Lmbr1	G	T	5: 29,346,865	A74E	probably damaging	Het
Lonp1	A	C	17: 56,622,511	H175Q	probably benign	Het
Maml2	T	C	9: 13,620,075	F195S	probably damaging	Het
Man2b2	G	T	5: 36,817,639	T436K	probably benign	Het
Man2c1	T	C	9: 57,142,155		probably null	Het
Mettl11b	A	T	1: 163,725,028	F10I	probably damaging	Het
Mrps15	G	A	4: 126,047,044		probably benign	Het
Mtrf1l	C	A	10: 5,817,586	V177F	probably benign	Het
Naxd	A	T	8: 11,509,489	I213F	probably damaging	Het
Nbeal1	T	A	1: 60,228,731		probably benign	Het
Nfatc1	T	C	18: 80,697,832	I318V	probably damaging	Het
Nid2	T	A	14: 19,808,010	I1297N	probably damaging	Het
Nol10	T	C	12: 17,348,561	V3A	probably damaging	Het
Nop14	G	T	5: 34,639,218	P765Q	probably damaging	Het
Noxa1	C	T	2: 25,091,749	G114D	probably damaging	Het
Olfr1100	A	G	2: 86,978,274	I174T	possibly damaging	Het
Olfr1342	A	T	4: 118,689,470		probably benign	Het
Olfr714	G	A	7: 107,074,554	C242Y	probably damaging	Het
Olfr73	A	G	2: 88,034,554	V195A	probably benign	Het
Opa1	T	C	16: 29,587,039	W141R	probably damaging	Het
Pde4d	A	T	13: 109,933,877	M7L	probably benign	Het
Phykpl	G	A	11: 51,592,229	A188T	probably damaging	Het
Pkd2l1	C	A	19: 44,154,134	A490S	probably damaging	Het
Pkhd1l1	T	A	15: 44,539,682	V2260D	probably damaging	Het
Ptprt	T	C	2: 161,553,845	E1136G	probably damaging	Het
Rad21	A	T	15: 51,970,024	L353Q	probably damaging	Het
Rfx4	G	T	10: 84,880,896	A425S	probably benign	Het
Rnf38	A	G	4: 44,142,450	S169P	probably damaging	Het
Samd9l	C	A	6: 3,376,347	V305F	probably damaging	Het
Serpini1	A	G	3: 75,616,576	K164E	probably benign	Het
Sirt6	A	G	10: 81,626,574	L37P	probably damaging	Het
Sorbs1	T	C	19: 40,373,518	T141A	probably damaging	Het
Tacc2	A	T	7: 130,626,216	T1563S	probably benign	Het
Tbc1d14	A	C	5: 36,530,381		probably benign	Het
Tbrg4	G	A	11: 6,620,185		probably benign	Het
Tox2	T	C	2: 163,320,647	L479P	probably damaging	Het
Tpp1	A	T	7: 105,751,706	L38Q	probably benign	Het
Trhr	A	G	15: 44,197,641	N186D	probably benign	Het
Trmt1l	C	T	1: 151,454,048	Q581*	probably null	Het
Tsen54	T	A	11: 115,815,421		probably benign	Het
Tsg101	A	G	7: 46,892,509	I138T	possibly damaging	Het
Usp22	A	G	11: 61,161,443	S237P	probably damaging	Het
Vmn1r209	A	G	13: 22,806,449	S24P	possibly damaging	Het
Vmn2r18	A	T	5: 151,584,959	H233Q	possibly damaging	Het
Vmn2r45	A	T	7: 8,483,437	I284N	probably benign	Het
Vmn2r66	T	C	7: 84,995,088	I705V	possibly damaging	Het
Vsig1	G	T	X: 140,926,386	A95S	probably benign	Het
Zdhhc11	T	A	13: 73,979,230	M242K	probably benign	Het
Zfp352	A	G	4: 90,225,081	K486R	probably benign	Het

Other mutations in Greb1l

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00485:Greb1l	APN	18	10555962	missense	possibly damaging	0.90
IGL01554:Greb1l	APN	18	10522144	missense	probably benign	0.01
IGL01563:Greb1l	APN	18	10469399	missense	probably damaging	0.99
IGL01944:Greb1l	APN	18	10557280	missense	possibly damaging	0.91
IGL02110:Greb1l	APN	18	10515271	missense	probably damaging	1.00
IGL02249:Greb1l	APN	18	10532961	missense	probably damaging	1.00
IGL02318:Greb1l	APN	18	10469388	missense	possibly damaging	0.91
IGL02340:Greb1l	APN	18	10515200	missense	probably damaging	0.99
IGL02516:Greb1l	APN	18	10537064	missense	probably benign	0.31
IGL02566:Greb1l	APN	18	10503299	missense	probably damaging	0.99
IGL02583:Greb1l	APN	18	10542362	missense	probably damaging	1.00
IGL02838:Greb1l	APN	18	10560430	missense	probably damaging	1.00
A4554:Greb1l	UTSW	18	10532862	missense	possibly damaging	0.58
PIT4453001:Greb1l	UTSW	18	10533031	missense	probably damaging	0.98
PIT4453001:Greb1l	UTSW	18	10533032	missense	probably benign	0.08
R0099:Greb1l	UTSW	18	10509158	missense	probably damaging	1.00
R0226:Greb1l	UTSW	18	10522076	intron	probably benign
R0234:Greb1l	UTSW	18	10560331	missense	probably damaging	1.00
R0234:Greb1l	UTSW	18	10560331	missense	probably damaging	1.00
R0239:Greb1l	UTSW	18	10458567	splice site	probably benign
R0316:Greb1l	UTSW	18	10547420	missense	probably damaging	1.00
R0369:Greb1l	UTSW	18	10469375	missense	possibly damaging	0.80
R0394:Greb1l	UTSW	18	10523374	missense	probably damaging	0.99
R0478:Greb1l	UTSW	18	10509281	missense	probably damaging	1.00
R0555:Greb1l	UTSW	18	10458781	splice site	probably benign
R0671:Greb1l	UTSW	18	10474303	missense	probably damaging	1.00
R1282:Greb1l	UTSW	18	10547289	missense	probably benign	0.13
R1574:Greb1l	UTSW	18	10554997	missense	possibly damaging	0.95
R1574:Greb1l	UTSW	18	10554997	missense	possibly damaging	0.95
R1607:Greb1l	UTSW	18	10529703	missense	possibly damaging	0.85
R1666:Greb1l	UTSW	18	10501080	critical splice donor site	probably null
R1666:Greb1l	UTSW	18	10529708	critical splice donor site	probably null
R1720:Greb1l	UTSW	18	10553848	missense	probably benign	0.19
R1808:Greb1l	UTSW	18	10542143	missense	probably benign
R1829:Greb1l	UTSW	18	10509314	missense	probably damaging	1.00
R1897:Greb1l	UTSW	18	10498992	missense	probably benign	0.00
R1967:Greb1l	UTSW	18	10501049	missense	possibly damaging	0.91
R2025:Greb1l	UTSW	18	10515221	missense	possibly damaging	0.71
R2086:Greb1l	UTSW	18	10523281	missense	probably damaging	1.00
R2125:Greb1l	UTSW	18	10511422	missense	probably damaging	0.98
R2139:Greb1l	UTSW	18	10555011	missense	probably damaging	1.00
R2255:Greb1l	UTSW	18	10554857	missense	probably damaging	1.00
R2256:Greb1l	UTSW	18	10503307	missense	possibly damaging	0.91
R2257:Greb1l	UTSW	18	10503307	missense	possibly damaging	0.91
R2880:Greb1l	UTSW	18	10547288	missense	possibly damaging	0.93
R3623:Greb1l	UTSW	18	10542380	missense	probably damaging	0.99
R3778:Greb1l	UTSW	18	10469444	missense	possibly damaging	0.60
R3975:Greb1l	UTSW	18	10522247	missense	possibly damaging	0.71
R4038:Greb1l	UTSW	18	10515209	missense	possibly damaging	0.93
R4062:Greb1l	UTSW	18	10522150	missense	probably damaging	0.99
R4134:Greb1l	UTSW	18	10529708	critical splice donor site	probably null
R4342:Greb1l	UTSW	18	10544561	missense	probably benign	0.12
R4409:Greb1l	UTSW	18	10503182	missense	possibly damaging	0.70
R4600:Greb1l	UTSW	18	10553705	missense	probably damaging	1.00
R4683:Greb1l	UTSW	18	10529563	splice site	probably null
R4686:Greb1l	UTSW	18	10522112	missense	probably damaging	0.98
R4707:Greb1l	UTSW	18	10532922	missense	probably benign	0.02
R4780:Greb1l	UTSW	18	10541792	missense	probably benign	0.00
R4819:Greb1l	UTSW	18	10458358	missense	probably damaging	1.00
R4925:Greb1l	UTSW	18	10547447	missense	possibly damaging	0.79
R4960:Greb1l	UTSW	18	10547306	missense	probably damaging	0.99
R5150:Greb1l	UTSW	18	10555950	frame shift	probably null
R5154:Greb1l	UTSW	18	10458312	missense	probably benign	0.02
R5269:Greb1l	UTSW	18	10511409	missense	probably benign
R5290:Greb1l	UTSW	18	10542427	missense	probably damaging	1.00
R5310:Greb1l	UTSW	18	10542427	missense	probably damaging	1.00
R5328:Greb1l	UTSW	18	10553720	missense	probably damaging	1.00
R5337:Greb1l	UTSW	18	10509143	missense	probably damaging	1.00
R5393:Greb1l	UTSW	18	10458312	missense	probably benign	0.02
R5402:Greb1l	UTSW	18	10537169	missense	probably benign	0.26
R5718:Greb1l	UTSW	18	10542427	missense	probably damaging	1.00
R5719:Greb1l	UTSW	18	10542427	missense	probably damaging	1.00
R5720:Greb1l	UTSW	18	10542427	missense	probably damaging	1.00
R5721:Greb1l	UTSW	18	10542427	missense	probably damaging	1.00
R5902:Greb1l	UTSW	18	10538302	missense	probably benign	0.00
R5993:Greb1l	UTSW	18	10544455	missense	probably benign	0.10
R6035:Greb1l	UTSW	18	10501025	missense	possibly damaging	0.91
R6035:Greb1l	UTSW	18	10501025	missense	possibly damaging	0.91
R6045:Greb1l	UTSW	18	10547068	missense	probably damaging	1.00
R6063:Greb1l	UTSW	18	10557340	missense	probably damaging	1.00
R6297:Greb1l	UTSW	18	10469494	missense	probably damaging	1.00
R6405:Greb1l	UTSW	18	10501076	missense	probably benign	0.30
R6552:Greb1l	UTSW	18	10541814	missense	probably benign	0.00
R6572:Greb1l	UTSW	18	10522131	missense	probably benign	0.07
R6575:Greb1l	UTSW	18	10547347	missense	possibly damaging	0.88
R6922:Greb1l	UTSW	18	10547482	missense	possibly damaging	0.88
R6957:Greb1l	UTSW	18	10558786	missense	probably benign	0.23
R6962:Greb1l	UTSW	18	10547327	missense	probably damaging	1.00
R7012:Greb1l	UTSW	18	10529707	critical splice donor site	probably null
R7179:Greb1l	UTSW	18	10544576	missense	probably benign	0.00
R7251:Greb1l	UTSW	18	10515319	missense	probably damaging	1.00
R7275:Greb1l	UTSW	18	10544561	missense	probably benign	0.12
R7301:Greb1l	UTSW	18	10544970	missense	probably damaging	1.00
R7307:Greb1l	UTSW	18	10538142	missense	probably damaging	0.99
R7455:Greb1l	UTSW	18	10554915	missense	probably damaging	1.00
R7832:Greb1l	UTSW	18	10542056	missense	probably benign	0.38
R7934:Greb1l	UTSW	18	10474371	nonsense	probably null
R8137:Greb1l	UTSW	18	10474357	missense	possibly damaging	0.77
R8138:Greb1l	UTSW	18	10533060	missense	probably benign	0.13
R8208:Greb1l	UTSW	18	10510703	missense	probably damaging	1.00
R8227:Greb1l	UTSW	18	10515371	missense	probably damaging	1.00
R8312:Greb1l	UTSW	18	10511587	intron	probably benign
R8331:Greb1l	UTSW	18	10458706	missense	possibly damaging	0.96
R8364:Greb1l	UTSW	18	10529687	missense	possibly damaging	0.85
R8389:Greb1l	UTSW	18	10529613	missense	probably benign	0.00
R8695:Greb1l	UTSW	18	10544450	missense	probably benign	0.01
R8795:Greb1l	UTSW	18	10553739	missense	probably damaging	0.98
R8836:Greb1l	UTSW	18	10509257	missense	probably benign	0.30
R8862:Greb1l	UTSW	18	10555042	missense	possibly damaging	0.90
R8872:Greb1l	UTSW	18	10529684	missense	probably benign	0.18
R8874:Greb1l	UTSW	18	10544896	missense	probably benign	0.01
R8886:Greb1l	UTSW	18	10553843	missense	probably benign	0.21
R8921:Greb1l	UTSW	18	10541825	missense	probably benign	0.01
R8997:Greb1l	UTSW	18	10510747	missense	probably damaging	1.00
R9015:Greb1l	UTSW	18	10541675	missense	probably benign	0.00
R9018:Greb1l	UTSW	18	10542004	missense	possibly damaging	0.76
R9074:Greb1l	UTSW	18	10532797	missense	probably damaging	1.00
R9074:Greb1l	UTSW	18	10558795	missense	probably damaging	1.00
R9117:Greb1l	UTSW	18	10542422	missense	probably benign	0.31
R9189:Greb1l	UTSW	18	10499983	missense	probably benign
R9332:Greb1l	UTSW	18	10532796	missense	possibly damaging	0.92
R9367:Greb1l	UTSW	18	10522130	missense	probably benign	0.00
R9497:Greb1l	UTSW	18	10458600	missense	probably benign	0.00
R9796:Greb1l	UTSW	18	10538233	missense	possibly damaging	0.69
Z1176:Greb1l	UTSW	18	10515305	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGTGAAGGCAATTGTTCTGATG -3'
(R):5'- TCCGGGTTCATTGAGAGATTC -3'

Sequencing Primer
(F):5'- AAGGCAATTGTTCTGATGGTTAGAGC -3'
(R):5'- GTAGACTTTGAACCTTCACACACATG -3'

Posted On

2015-09-25