Incidental Mutation 'R4618:Greb1l'
ID345141
Institutional Source Beutler Lab
Gene Symbol Greb1l
Ensembl Gene ENSMUSG00000042942
Gene Namegrowth regulation by estrogen in breast cancer-like
SynonymsAK220484, mKIAA4095
MMRRC Submission 041884-MU
Accession Numbers

Genbank: NM_001083628; MGI: 3576497

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4618 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location10325177-10562934 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 10498965 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 283 (T283A)
Ref Sequence ENSEMBL: ENSMUSP00000134090 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048977] [ENSMUST00000172532]
Predicted Effect probably benign
Transcript: ENSMUST00000048977
AA Change: T283A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000049003
Gene: ENSMUSG00000042942
AA Change: T283A

DomainStartEndE-ValueType
Pfam:GREB1 1 1172 N/A PFAM
Pfam:GREB1 1154 1913 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000172532
AA Change: T283A

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000134090
Gene: ENSMUSG00000042942
AA Change: T283A

DomainStartEndE-ValueType
low complexity region 83 100 N/A INTRINSIC
low complexity region 282 301 N/A INTRINSIC
low complexity region 606 617 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173356
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224958
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 98% (89/91)
Allele List at MGI

All alleles(5) : Targeted, other(2) Gene trapped(3)

Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930432M17Rik A T 3: 121,679,446 K83N unknown Het
Adamtsl3 T A 7: 82,606,520 M1580K probably benign Het
Adprhl1 A G 8: 13,242,250 probably null Het
Akap3 G T 6: 126,866,443 C675F probably benign Het
Asap1 A T 15: 64,152,895 H318Q probably damaging Het
Atf7ip G T 6: 136,565,106 A18S probably damaging Het
Bcl2a1a A C 9: 88,957,304 N85T probably damaging Het
Btnl6 G A 17: 34,514,146 P248S probably damaging Het
C9 A G 15: 6,491,463 D51G probably damaging Het
Ccdc14 T A 16: 34,706,495 C257S probably benign Het
Cd5l A G 3: 87,368,619 T299A probably benign Het
Endou C T 15: 97,713,882 V292M possibly damaging Het
Fbxo36 T C 1: 84,900,028 I137T probably damaging Het
Fcer1a T C 1: 173,222,641 I161V possibly damaging Het
Fsip2 A G 2: 82,987,759 Y4612C probably benign Het
Gcnt2 T A 13: 40,958,194 L353* probably null Het
Ghrhr T C 6: 55,381,754 F172S probably damaging Het
Gins1 T A 2: 150,917,861 probably null Het
Gm16519 T G 17: 70,929,242 L62R probably damaging Het
Gm4758 T A 16: 36,312,590 D76E possibly damaging Het
Gpr20 T C 15: 73,695,736 N268S probably benign Het
Grin2c T A 11: 115,252,747 D729V probably damaging Het
Heatr4 T G 12: 83,978,067 T327P probably damaging Het
Hes2 A C 4: 152,160,388 S105R probably benign Het
Hsph1 A G 5: 149,618,843 V705A probably benign Het
Ighv1-82 T C 12: 115,952,660 T77A probably benign Het
Itih1 A T 14: 30,929,831 D851E probably benign Het
Klhdc7b A G 15: 89,387,269 T785A probably benign Het
Lmbr1 G T 5: 29,346,865 A74E probably damaging Het
Lonp1 A C 17: 56,622,511 H175Q probably benign Het
Maml2 T C 9: 13,620,075 F195S probably damaging Het
Man2b2 G T 5: 36,817,639 T436K probably benign Het
Man2c1 T C 9: 57,142,155 probably null Het
Mettl11b A T 1: 163,725,028 F10I probably damaging Het
Mrps15 G A 4: 126,047,044 probably benign Het
Mtrf1l C A 10: 5,817,586 V177F probably benign Het
Naxd A T 8: 11,509,489 I213F probably damaging Het
Nbeal1 T A 1: 60,228,731 probably benign Het
Nfatc1 T C 18: 80,697,832 I318V probably damaging Het
Nid2 T A 14: 19,808,010 I1297N probably damaging Het
Nol10 T C 12: 17,348,561 V3A probably damaging Het
Nop14 G T 5: 34,639,218 P765Q probably damaging Het
Noxa1 C T 2: 25,091,749 G114D probably damaging Het
Olfr1100 A G 2: 86,978,274 I174T possibly damaging Het
Olfr1342 A T 4: 118,689,470 probably benign Het
Olfr714 G A 7: 107,074,554 C242Y probably damaging Het
Olfr73 A G 2: 88,034,554 V195A probably benign Het
Opa1 T C 16: 29,587,039 W141R probably damaging Het
Pde4d A T 13: 109,933,877 M7L probably benign Het
Phykpl G A 11: 51,592,229 A188T probably damaging Het
Pkd2l1 C A 19: 44,154,134 A490S probably damaging Het
Pkhd1l1 T A 15: 44,539,682 V2260D probably damaging Het
Ptprt T C 2: 161,553,845 E1136G probably damaging Het
Rad21 A T 15: 51,970,024 L353Q probably damaging Het
Rfx4 G T 10: 84,880,896 A425S probably benign Het
Rnf38 A G 4: 44,142,450 S169P probably damaging Het
Samd9l C A 6: 3,376,347 V305F probably damaging Het
Serpini1 A G 3: 75,616,576 K164E probably benign Het
Sirt6 A G 10: 81,626,574 L37P probably damaging Het
Sorbs1 T C 19: 40,373,518 T141A probably damaging Het
Tacc2 A T 7: 130,626,216 T1563S probably benign Het
Tbc1d14 A C 5: 36,530,381 probably benign Het
Tbrg4 G A 11: 6,620,185 probably benign Het
Tox2 T C 2: 163,320,647 L479P probably damaging Het
Tpp1 A T 7: 105,751,706 L38Q probably benign Het
Trhr A G 15: 44,197,641 N186D probably benign Het
Trmt1l C T 1: 151,454,048 Q581* probably null Het
Tsen54 T A 11: 115,815,421 probably benign Het
Tsg101 A G 7: 46,892,509 I138T possibly damaging Het
Usp22 A G 11: 61,161,443 S237P probably damaging Het
Vmn1r209 A G 13: 22,806,449 S24P possibly damaging Het
Vmn2r18 A T 5: 151,584,959 H233Q possibly damaging Het
Vmn2r45 A T 7: 8,483,437 I284N probably benign Het
Vmn2r66 T C 7: 84,995,088 I705V possibly damaging Het
Vsig1 G T X: 140,926,386 A95S probably benign Het
Zdhhc11 T A 13: 73,979,230 M242K probably benign Het
Zfp352 A G 4: 90,225,081 K486R probably benign Het
Other mutations in Greb1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00485:Greb1l APN 18 10555962 missense possibly damaging 0.90
IGL01554:Greb1l APN 18 10522144 missense probably benign 0.01
IGL01563:Greb1l APN 18 10469399 missense probably damaging 0.99
IGL01944:Greb1l APN 18 10557280 missense possibly damaging 0.91
IGL02110:Greb1l APN 18 10515271 missense probably damaging 1.00
IGL02249:Greb1l APN 18 10532961 missense probably damaging 1.00
IGL02318:Greb1l APN 18 10469388 missense possibly damaging 0.91
IGL02340:Greb1l APN 18 10515200 missense probably damaging 0.99
IGL02516:Greb1l APN 18 10537064 missense probably benign 0.31
IGL02566:Greb1l APN 18 10503299 missense probably damaging 0.99
IGL02583:Greb1l APN 18 10542362 missense probably damaging 1.00
IGL02838:Greb1l APN 18 10560430 missense probably damaging 1.00
A4554:Greb1l UTSW 18 10532862 missense possibly damaging 0.58
PIT4453001:Greb1l UTSW 18 10533031 missense probably damaging 0.98
PIT4453001:Greb1l UTSW 18 10533032 missense probably benign 0.08
R0099:Greb1l UTSW 18 10509158 missense probably damaging 1.00
R0226:Greb1l UTSW 18 10522076 intron probably benign
R0234:Greb1l UTSW 18 10560331 missense probably damaging 1.00
R0234:Greb1l UTSW 18 10560331 missense probably damaging 1.00
R0239:Greb1l UTSW 18 10458567 splice site probably benign
R0316:Greb1l UTSW 18 10547420 missense probably damaging 1.00
R0369:Greb1l UTSW 18 10469375 missense possibly damaging 0.80
R0394:Greb1l UTSW 18 10523374 missense probably damaging 0.99
R0478:Greb1l UTSW 18 10509281 missense probably damaging 1.00
R0555:Greb1l UTSW 18 10458781 splice site probably benign
R0671:Greb1l UTSW 18 10474303 missense probably damaging 1.00
R1282:Greb1l UTSW 18 10547289 missense probably benign 0.13
R1574:Greb1l UTSW 18 10554997 missense possibly damaging 0.95
R1574:Greb1l UTSW 18 10554997 missense possibly damaging 0.95
R1607:Greb1l UTSW 18 10529703 missense possibly damaging 0.85
R1666:Greb1l UTSW 18 10501080 critical splice donor site probably null
R1666:Greb1l UTSW 18 10529708 critical splice donor site probably null
R1720:Greb1l UTSW 18 10553848 missense probably benign 0.19
R1808:Greb1l UTSW 18 10542143 missense probably benign
R1829:Greb1l UTSW 18 10509314 missense probably damaging 1.00
R1897:Greb1l UTSW 18 10498992 missense probably benign 0.00
R1967:Greb1l UTSW 18 10501049 missense possibly damaging 0.91
R2025:Greb1l UTSW 18 10515221 missense possibly damaging 0.71
R2086:Greb1l UTSW 18 10523281 missense probably damaging 1.00
R2125:Greb1l UTSW 18 10511422 missense probably damaging 0.98
R2139:Greb1l UTSW 18 10555011 missense probably damaging 1.00
R2255:Greb1l UTSW 18 10554857 missense probably damaging 1.00
R2256:Greb1l UTSW 18 10503307 missense possibly damaging 0.91
R2257:Greb1l UTSW 18 10503307 missense possibly damaging 0.91
R2880:Greb1l UTSW 18 10547288 missense possibly damaging 0.93
R3623:Greb1l UTSW 18 10542380 missense probably damaging 0.99
R3778:Greb1l UTSW 18 10469444 missense possibly damaging 0.60
R3975:Greb1l UTSW 18 10522247 missense possibly damaging 0.71
R4038:Greb1l UTSW 18 10515209 missense possibly damaging 0.93
R4062:Greb1l UTSW 18 10522150 missense probably damaging 0.99
R4134:Greb1l UTSW 18 10529708 critical splice donor site probably null
R4342:Greb1l UTSW 18 10544561 missense probably benign 0.12
R4409:Greb1l UTSW 18 10503182 missense possibly damaging 0.70
R4600:Greb1l UTSW 18 10553705 missense probably damaging 1.00
R4683:Greb1l UTSW 18 10529563 splice site probably null
R4686:Greb1l UTSW 18 10522112 missense probably damaging 0.98
R4707:Greb1l UTSW 18 10532922 missense probably benign 0.02
R4780:Greb1l UTSW 18 10541792 missense probably benign 0.00
R4819:Greb1l UTSW 18 10458358 missense probably damaging 1.00
R4925:Greb1l UTSW 18 10547447 missense possibly damaging 0.79
R4960:Greb1l UTSW 18 10547306 missense probably damaging 0.99
R5150:Greb1l UTSW 18 10555950 frame shift probably null
R5154:Greb1l UTSW 18 10458312 missense probably benign 0.02
R5269:Greb1l UTSW 18 10511409 missense probably benign
R5290:Greb1l UTSW 18 10542427 missense probably damaging 1.00
R5310:Greb1l UTSW 18 10542427 missense probably damaging 1.00
R5328:Greb1l UTSW 18 10553720 missense probably damaging 1.00
R5337:Greb1l UTSW 18 10509143 missense probably damaging 1.00
R5393:Greb1l UTSW 18 10458312 missense probably benign 0.02
R5402:Greb1l UTSW 18 10537169 missense probably benign 0.26
R5718:Greb1l UTSW 18 10542427 missense probably damaging 1.00
R5719:Greb1l UTSW 18 10542427 missense probably damaging 1.00
R5720:Greb1l UTSW 18 10542427 missense probably damaging 1.00
R5721:Greb1l UTSW 18 10542427 missense probably damaging 1.00
R5902:Greb1l UTSW 18 10538302 missense probably benign 0.00
R5993:Greb1l UTSW 18 10544455 missense probably benign 0.10
R6035:Greb1l UTSW 18 10501025 missense possibly damaging 0.91
R6035:Greb1l UTSW 18 10501025 missense possibly damaging 0.91
R6045:Greb1l UTSW 18 10547068 missense probably damaging 1.00
R6063:Greb1l UTSW 18 10557340 missense probably damaging 1.00
R6297:Greb1l UTSW 18 10469494 missense probably damaging 1.00
R6405:Greb1l UTSW 18 10501076 missense probably benign 0.30
R6552:Greb1l UTSW 18 10541814 missense probably benign 0.00
R6572:Greb1l UTSW 18 10522131 missense probably benign 0.07
R6575:Greb1l UTSW 18 10547347 missense possibly damaging 0.88
R6922:Greb1l UTSW 18 10547482 missense possibly damaging 0.88
R6957:Greb1l UTSW 18 10558786 missense probably benign 0.23
R6962:Greb1l UTSW 18 10547327 missense probably damaging 1.00
R7012:Greb1l UTSW 18 10529707 critical splice donor site probably null
R7179:Greb1l UTSW 18 10544576 missense probably benign 0.00
R7251:Greb1l UTSW 18 10515319 missense probably damaging 1.00
R7275:Greb1l UTSW 18 10544561 missense probably benign 0.12
R7301:Greb1l UTSW 18 10544970 missense probably damaging 1.00
R7307:Greb1l UTSW 18 10538142 missense probably damaging 0.99
R7455:Greb1l UTSW 18 10554915 missense probably damaging 1.00
R7832:Greb1l UTSW 18 10542056 missense probably benign 0.38
R7934:Greb1l UTSW 18 10474371 nonsense probably null
R8137:Greb1l UTSW 18 10474357 missense possibly damaging 0.77
R8138:Greb1l UTSW 18 10533060 missense probably benign 0.13
R8208:Greb1l UTSW 18 10510703 missense probably damaging 1.00
R8227:Greb1l UTSW 18 10515371 missense probably damaging 1.00
R8312:Greb1l UTSW 18 10511587 intron probably benign
R8331:Greb1l UTSW 18 10458706 missense possibly damaging 0.96
R8364:Greb1l UTSW 18 10529687 missense possibly damaging 0.85
R8389:Greb1l UTSW 18 10529613 missense probably benign 0.00
R8695:Greb1l UTSW 18 10544450 missense probably benign 0.01
R8795:Greb1l UTSW 18 10553739 missense probably damaging 0.98
R8836:Greb1l UTSW 18 10509257 missense probably benign 0.30
R8862:Greb1l UTSW 18 10555042 missense possibly damaging 0.90
R8872:Greb1l UTSW 18 10529684 missense probably benign 0.18
R8874:Greb1l UTSW 18 10544896 missense probably benign 0.01
Z1176:Greb1l UTSW 18 10515305 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTGAAGGCAATTGTTCTGATG -3'
(R):5'- TCCGGGTTCATTGAGAGATTC -3'

Sequencing Primer
(F):5'- AAGGCAATTGTTCTGATGGTTAGAGC -3'
(R):5'- GTAGACTTTGAACCTTCACACACATG -3'
Posted On2015-09-25