Mutagenetix > Incidental Mutation

Incidental Mutation 'R4619:Krt2'

345200

Institutional Source

Beutler Lab

Gene Symbol

Krt2

Ensembl Gene

ENSMUSG00000064201

Gene Name

keratin 2

Synonyms

Krt2-17, Krt2-2, Krt2e

MMRRC Submission

041885-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.131) question?

Stock #

R4619 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

101810689-101818169 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 101817591 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Phenylalanine at position 171 (I171F)

Ref Sequence

ENSEMBL: ENSMUSP00000023712 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000023712]

AlphaFold

Q3TTY5

Predicted Effect

probably damaging
Transcript: ENSMUST00000023712
AA Change: I171F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000023712
Gene: ENSMUSG00000064201
AA Change: I171F

Domain	Start	End	E-Value	Type
Pfam:Keratin_2_head	23	195	3.6e-26	PFAM
Filament	198	511	4.22e-152	SMART
low complexity region	520	533	N/A	INTRINSIC
low complexity region	538	701	N/A	INTRINSIC

Meta Mutation Damage Score

0.1075

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.0%
20x: 94.5%

Validation Efficiency

100% (74/74)

MGI Phenotype

PHENOTYPE: ENU-induced mutant mice exhibit scaly skin and increased pigmentation in the tail, ears and feet. Mice homozygous for a knock-out allele show scaly skin, acanthosis, hyperkeratosis, increased water loss, ear skin inflammation, and aberrant aggregation of keratin 10 in suprabasal epidermal keratinocytes. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110002E22Rik	G	A	3: 138,069,759	V1570I	probably damaging	Het
Alx4	A	G	2: 93,642,761	R35G	probably damaging	Het
Apod	T	C	16: 31,297,393	D173G	probably benign	Het
Atp8b3	G	A	10: 80,526,024	T731I	possibly damaging	Het
Birc6	A	C	17: 74,640,150	T2955P	probably benign	Het
Cdh15	G	A	8: 122,860,873	D179N	probably damaging	Het
Cntnap5c	G	T	17: 58,410,268	V1282L	probably benign	Het
Crocc2	G	A	1: 93,213,650	R1175H	probably benign	Het
Dbh	A	G	2: 27,174,824	D349G	probably damaging	Het
Dync1h1	A	G	12: 110,638,844	I2372V	probably benign	Het
Fam196a	A	G	7: 134,918,541	Y87H	probably damaging	Het
Fer1l4	A	T	2: 156,047,087	W389R	probably damaging	Het
Fndc1	T	C	17: 7,765,204	T1297A	unknown	Het
Gart	T	C	16: 91,625,433	N732S	probably damaging	Het
Gas2l2	T	C	11: 83,423,098	I463V	probably benign	Het
Gm5591	G	A	7: 38,520,648	S267L	probably benign	Het
Gzmk	A	G	13: 113,173,123	V92A	probably damaging	Het
Hspg2	C	T	4: 137,546,573	R2680W	probably damaging	Het
Kcnh3	G	A	15: 99,234,101	V646M	probably damaging	Het
Kcnk7	A	C	19: 5,706,435	I230L	probably benign	Het
Kif3b	C	T	2: 153,316,674	R132*	probably null	Het
Klra5	T	C	6: 129,908,813	S128G	probably benign	Het
Krba1	C	T	6: 48,406,348	R4*	probably null	Het
Lss	A	G	10: 76,536,255	D148G	probably benign	Het
Mavs	G	T	2: 131,240,450	A85S	probably damaging	Het
Mipep	T	C	14: 60,903,416	C566R	probably damaging	Het
Myocd	T	A	11: 65,178,428		probably benign	Het
Ndufa9	C	T	6: 126,827,535		probably null	Het
Nolc1	G	A	19: 46,083,520	G583D	probably damaging	Het
Nucb2	T	C	7: 116,527,824		probably null	Het
Olfr1357	T	C	10: 78,612,575	D22G	probably benign	Het
Olfr487	A	T	7: 108,212,094	I145N	possibly damaging	Het
Olfr596	C	T	7: 103,309,958	T79I	probably benign	Het
Pank4	C	A	4: 154,976,619	D508E	probably benign	Het
Phb	T	A	11: 95,671,590		probably benign	Het
Pign	T	A	1: 105,521,990		probably benign	Het
Plec	T	C	15: 76,192,182	K349E	probably benign	Het
Ppp1r3c	A	T	19: 36,734,343	V9E	possibly damaging	Het
Rap1gap	T	A	4: 137,716,111	V130D	probably damaging	Het
Senp3	T	A	11: 69,677,118	Y432F	probably benign	Het
Serpina3f	T	C	12: 104,217,290	I137T	possibly damaging	Het
Slc46a3	T	A	5: 147,886,730	K101*	probably null	Het
Snph	G	A	2: 151,594,514	Q96*	probably null	Het
Sptb	A	T	12: 76,583,807	C2244*	probably null	Het
Srbd1	A	T	17: 86,109,265	F488L	probably benign	Het
Ssc5d	A	T	7: 4,929,525	H396L	probably damaging	Het
Sulf1	A	C	1: 12,786,652	R42S	probably damaging	Het
Taf1a	T	A	1: 183,400,598		probably benign	Het
Thoc5	T	A	11: 4,926,218	M609K	probably damaging	Het
Tiam2	A	T	17: 3,518,342	I1588F	probably damaging	Het
Tmcc1	C	T	6: 116,043,286	V402I	probably damaging	Het
Tmprss15	T	C	16: 79,021,470	D524G	probably damaging	Het
Trbv31	T	C	6: 41,557,967	I21V	probably benign	Het
Vmn1r74	A	T	7: 11,847,471	T233S	possibly damaging	Het
Vmn1r74	G	C	7: 11,847,476	Q234H	probably damaging	Het
Vsx1	A	T	2: 150,688,609	S118T	probably benign	Het
Wnt9b	G	A	11: 103,731,123	T236I	probably benign	Het
Zbtb21	T	C	16: 97,949,892	T1092A	possibly damaging	Het
Zc3hc1	G	A	6: 30,387,524	T52I	probably benign	Het
Zfp558	T	A	9: 18,456,281	N404Y	possibly damaging	Het
Zfp735	A	T	11: 73,711,205	D325V	probably damaging	Het
Zhx3	A	T	2: 160,781,959	M96K	probably damaging	Het

Other mutations in Krt2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01316:Krt2	APN	15	101811211	missense	probably benign	0.23
IGL01568:Krt2	APN	15	101813211	missense	probably damaging	1.00
IGL01586:Krt2	APN	15	101811390	missense	unknown
IGL01667:Krt2	APN	15	101816330	missense	possibly damaging	0.85
IGL02017:Krt2	APN	15	101816504	missense	probably damaging	1.00
IGL02022:Krt2	APN	15	101816518	missense	probably damaging	1.00
IGL02538:Krt2	APN	15	101811154	missense	unknown
IGL02959:Krt2	APN	15	101811328	missense	unknown
IGL03295:Krt2	APN	15	101816429	missense	probably damaging	0.99
R0195:Krt2	UTSW	15	101813191	nonsense	probably null
R0472:Krt2	UTSW	15	101813253	missense	probably damaging	1.00
R0749:Krt2	UTSW	15	101817663	missense	unknown
R0785:Krt2	UTSW	15	101817921	missense	unknown
R0792:Krt2	UTSW	15	101816497	missense	probably damaging	1.00
R1232:Krt2	UTSW	15	101811784	missense	probably damaging	1.00
R1281:Krt2	UTSW	15	101813292	missense	probably damaging	1.00
R1770:Krt2	UTSW	15	101811154	missense	unknown
R1783:Krt2	UTSW	15	101813973	missense	probably damaging	1.00
R1795:Krt2	UTSW	15	101816426	missense	possibly damaging	0.85
R2283:Krt2	UTSW	15	101814387	missense	probably damaging	1.00
R3977:Krt2	UTSW	15	101811127	missense	unknown
R4575:Krt2	UTSW	15	101814486	missense	probably damaging	1.00
R4620:Krt2	UTSW	15	101817591	missense	probably damaging	1.00
R4766:Krt2	UTSW	15	101813960	missense	probably damaging	1.00
R4819:Krt2	UTSW	15	101811544	missense	unknown
R4953:Krt2	UTSW	15	101813942	missense	probably damaging	1.00
R5108:Krt2	UTSW	15	101813286	missense	possibly damaging	0.88
R5973:Krt2	UTSW	15	101816312	missense	probably damaging	0.99
R6122:Krt2	UTSW	15	101815914	missense	probably damaging	1.00
R6180:Krt2	UTSW	15	101815044	missense	probably benign	0.05
R6661:Krt2	UTSW	15	101815963	missense	probably damaging	1.00
R6974:Krt2	UTSW	15	101817879	missense	unknown
R6993:Krt2	UTSW	15	101815960	missense	probably damaging	1.00
R7104:Krt2	UTSW	15	101815087	missense	probably benign	0.09
R7573:Krt2	UTSW	15	101814519	missense	probably benign	0.05
R7947:Krt2	UTSW	15	101816334	missense	probably damaging	1.00
R8469:Krt2	UTSW	15	101816369	missense	probably benign	0.22
R8805:Krt2	UTSW	15	101815944	missense	possibly damaging	0.93
R9051:Krt2	UTSW	15	101817882	missense	unknown
R9118:Krt2	UTSW	15	101814541	missense	probably damaging	0.99
R9230:Krt2	UTSW	15	101817513	missense	probably benign	0.39
R9257:Krt2	UTSW	15	101816491	missense	probably benign	0.05
R9424:Krt2	UTSW	15	101811357	missense	unknown
R9569:Krt2	UTSW	15	101816489	missense	probably damaging	1.00
R9576:Krt2	UTSW	15	101811357	missense	unknown
RF020:Krt2	UTSW	15	101817968	missense	unknown
Z1177:Krt2	UTSW	15	101811550	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- TCTCATGACAGAAGGTGCGG -3'
(R):5'- GAGCATCTCTAGTAGCGTGG -3'

Sequencing Primer
(F):5'- GCGGCCTCTCCCACTCAC -3'
(R):5'- TCTAGTAGCGTGGCTGGCAAC -3'

Posted On

2015-09-25