Incidental Mutation 'R4620:Blvra'
ID345216
Institutional Source Beutler Lab
Gene Symbol Blvra
Ensembl Gene ENSMUSG00000001999
Gene Namebiliverdin reductase A
Synonyms0610006A11Rik, Blvr, 2500001N03Rik
MMRRC Submission 042008-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.090) question?
Stock #R4620 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location127070665-127097084 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 127096965 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 287 (I287T)
Ref Sequence ENSEMBL: ENSMUSP00000002064 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002064] [ENSMUST00000142737]
Predicted Effect probably damaging
Transcript: ENSMUST00000002064
AA Change: I287T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000002064
Gene: ENSMUSG00000001999
AA Change: I287T

DomainStartEndE-ValueType
Pfam:GFO_IDH_MocA 9 124 2.1e-22 PFAM
Pfam:Biliv-reduc_cat 132 244 2.6e-55 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000142737
SMART Domains Protein: ENSMUSP00000116825
Gene: ENSMUSG00000001999

DomainStartEndE-ValueType
Pfam:GFO_IDH_MocA 9 124 4.7e-24 PFAM
Pfam:NAD_binding_3 15 122 1.8e-8 PFAM
Meta Mutation Damage Score 0.7671 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 99% (80/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the biliverdin reductase family, members of which catalyze the conversion of biliverdin to bilirubin in the presence of NADPH or NADH. Mutations in this gene are associated with hyperbiliverdinemia. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Dec 2011]
PHENOTYPE: This locus controls electrophoretic mobility of biliverdin reductase. The a allele determines a slowly migrating band in C3H/He, C57BL/H and 101/H; the b allele determines a fast band in BALB/c, CBA/Ca, TFH/H and SM/J. Heterozygotes have both parental bands. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310057M21Rik A T 7: 131,343,606 Y433* probably null Het
Apba2 C T 7: 64,714,467 R331C probably damaging Het
Apod T C 16: 31,297,393 D173G probably benign Het
B3gnt5 A T 16: 19,769,882 M284L probably benign Het
Birc6 A C 17: 74,640,150 T2955P probably benign Het
Capn5 T C 7: 98,129,371 Y347C probably damaging Het
Cdcp2 A G 4: 107,106,730 E259G probably damaging Het
Cdh2 A G 18: 16,648,608 V85A probably benign Het
Cdk5rap2 A G 4: 70,266,706 I1169T probably benign Het
Cenpj A G 14: 56,535,454 V1043A probably damaging Het
Cfap54 T A 10: 92,969,757 H1497L probably benign Het
Chat A G 14: 32,453,818 M95T probably damaging Het
Csmd1 T C 8: 16,002,694 probably null Het
Csmd3 T C 15: 47,585,753 E3615G probably benign Het
Cyp2c68 A T 19: 39,712,562 probably null Het
Dll1 C T 17: 15,370,566 A332T probably benign Het
Dmrta1 A T 4: 89,688,784 Q159L probably benign Het
Eci3 A T 13: 34,948,758 M212K probably damaging Het
Eml4 T C 17: 83,461,533 F557L probably benign Het
Fat3 A T 9: 15,996,894 V2604D probably damaging Het
Frem3 T C 8: 80,668,957 V1871A possibly damaging Het
Gart T C 16: 91,625,433 N732S probably damaging Het
Gas2l2 T C 11: 83,423,098 I463V probably benign Het
H2-M3 C A 17: 37,272,419 T257K probably damaging Het
Hdgf A G 3: 87,914,576 N166S possibly damaging Het
Hoxb3 A T 11: 96,345,773 N226Y probably damaging Het
Itgav T C 2: 83,755,902 Y169H probably benign Het
Kalrn T G 16: 34,028,705 I426L probably damaging Het
Kcnh3 G A 15: 99,234,101 V646M probably damaging Het
Kif6 T C 17: 49,901,296 V735A probably benign Het
Krt2 T A 15: 101,817,591 I171F probably damaging Het
Megf8 G A 7: 25,355,098 A1880T possibly damaging Het
Miox A T 15: 89,336,121 Y172F probably benign Het
Myo18a G A 11: 77,817,947 R48H possibly damaging Het
Ndufb7 T C 8: 83,566,858 S14P probably damaging Het
Npepps A T 11: 97,238,244 H371Q probably damaging Het
Olfr596 C T 7: 103,309,958 T79I probably benign Het
Olfr672 T A 7: 104,996,623 I94F probably damaging Het
Olfr876 A G 9: 37,804,819 T303A probably benign Het
Olfr976 C T 9: 39,956,909 V9M probably damaging Het
Orc5 A T 5: 22,529,176 D203E probably damaging Het
Pappa A G 4: 65,327,028 T1518A probably benign Het
Pde6a A G 18: 61,262,492 D602G probably damaging Het
Pnliprp2 G A 19: 58,762,286 V136I possibly damaging Het
Postn A C 3: 54,376,993 D627A probably damaging Het
Prpf39 T C 12: 65,042,563 V25A probably benign Het
Pxdc1 A G 13: 34,652,314 I41T probably damaging Het
Rab11fip1 T A 8: 27,154,215 E514V probably damaging Het
Rag1 A T 2: 101,643,680 H372Q probably damaging Het
Ranbp1 A G 16: 18,240,104 probably benign Het
Rexo5 A G 7: 119,827,303 I317V probably benign Het
Rragc A G 4: 123,924,829 Q279R probably damaging Het
Sbf1 A G 15: 89,306,926 S187P probably damaging Het
Senp3 T A 11: 69,677,118 Y432F probably benign Het
Slfn5 G A 11: 82,961,652 C868Y probably damaging Het
Sorcs2 C T 5: 36,037,494 A722T probably benign Het
Sptb A T 12: 76,583,807 C2244* probably null Het
Srbd1 A T 17: 86,109,265 F488L probably benign Het
Sucnr1 A G 3: 60,086,769 I239M possibly damaging Het
Themis2 A G 4: 132,786,022 W298R probably damaging Het
Tmem168 T G 6: 13,594,953 N37T probably benign Het
Tmem62 A G 2: 120,996,364 probably benign Het
Tmprss15 T C 16: 79,021,470 D524G probably damaging Het
Trav5-4 G T 14: 53,704,396 M75I probably benign Het
Trio T A 15: 27,871,171 H620L probably damaging Het
Ubap2 C T 4: 41,233,698 G64E probably damaging Het
Usp32 C A 11: 85,059,127 probably null Het
Wdfy3 A T 5: 101,906,145 F1603Y probably damaging Het
Wdr63 A T 3: 146,042,809 L850Q probably damaging Het
Xpo4 A T 14: 57,630,325 L155Q probably damaging Het
Zbtb21 T C 16: 97,949,892 T1092A possibly damaging Het
Zfp780b A T 7: 27,962,753 Y792* probably null Het
Other mutations in Blvra
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03149:Blvra APN 2 127082951 missense probably damaging 1.00
R1084:Blvra UTSW 2 127080653 missense probably benign 0.00
R1932:Blvra UTSW 2 127095148 missense probably damaging 1.00
R2114:Blvra UTSW 2 127086069 nonsense probably null
R2115:Blvra UTSW 2 127086069 nonsense probably null
R2117:Blvra UTSW 2 127086069 nonsense probably null
R2122:Blvra UTSW 2 127086897 missense probably damaging 0.96
R3734:Blvra UTSW 2 127090255 intron probably benign
R3847:Blvra UTSW 2 127095191 missense probably damaging 0.96
R4110:Blvra UTSW 2 127095155 missense probably damaging 1.00
R4533:Blvra UTSW 2 127090384 splice site probably null
R4702:Blvra UTSW 2 127092062 missense probably benign 0.01
R5921:Blvra UTSW 2 127087363 intron probably benign
R6322:Blvra UTSW 2 127080539 start gained probably benign
R7474:Blvra UTSW 2 127086849 missense probably damaging 1.00
R7486:Blvra UTSW 2 127087323 missense unknown
R8188:Blvra UTSW 2 127095127 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACTTCAAATCTGGGTCCTTGG -3'
(R):5'- ACTTCAAGCTGTTCCACAAGAATG -3'

Sequencing Primer
(F):5'- TCCTTGGAGGAAGTGCCAAATG -3'
(R):5'- TATTCCTACAGGATGGCCCCAG -3'
Posted On2015-09-25