Mutagenetix > Incidental Mutation

Incidental Mutation 'R0254:Cubn'

34523

Institutional Source

Beutler Lab

Gene Symbol

Cubn

Ensembl Gene

ENSMUSG00000026726

Gene Name

cubilin (intrinsic factor-cobalamin receptor)

Synonyms

D2Wsu88e

MMRRC Submission

038485-MU

Accession Numbers

Genbank: NM_001081084; MGI: 1931256

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R0254 (G1)

Quality Score

154

Status

Validated

Chromosome

Chromosomal Location

13276338-13491813 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 13440514 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 1014 (T1014A)

Ref Sequence

ENSEMBL: ENSMUSP00000089009 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000091436]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000091436
AA Change: T1014A

PolyPhen 2 Score 0.843 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000089009
Gene: ENSMUSG00000026726
AA Change: T1014A

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
EGF	132	165	2.14e-5	SMART
EGF_CA	167	208	1.95e-8	SMART
EGF	213	258	2.85e-1	SMART
EGF_CA	260	301	2.66e-10	SMART
EGF_CA	302	345	7.07e-6	SMART
EGF	349	393	1.01e-1	SMART
EGF	398	430	3.73e-5	SMART
EGF_CA	432	468	8.63e-10	SMART
CUB	474	586	4.4e-21	SMART
CUB	590	702	3.82e-39	SMART
CUB	708	816	3.66e-18	SMART
CUB	817	928	3.09e-25	SMART
CUB	932	1042	1.29e-36	SMART
CUB	1048	1161	3.46e-37	SMART
CUB	1165	1277	7.24e-40	SMART
CUB	1278	1389	8.33e-31	SMART
CUB	1391	1506	3.08e-43	SMART
CUB	1510	1619	1.9e-34	SMART
CUB	1620	1734	7.24e-40	SMART
CUB	1738	1850	6.02e-37	SMART
CUB	1852	1963	1.57e-26	SMART
CUB	1978	2091	3.46e-28	SMART
CUB	2092	2213	2.88e-34	SMART
CUB	2217	2334	4.13e-35	SMART
CUB	2336	2448	3.1e-39	SMART
CUB	2452	2565	5.37e-34	SMART
CUB	2570	2687	3e-23	SMART
CUB	2689	2801	3.1e-39	SMART
CUB	2805	2919	2.36e-21	SMART
CUB	2920	3035	6.18e-25	SMART
CUB	3037	3150	5.16e-36	SMART
CUB	3157	3274	1.68e-35	SMART
CUB	3278	3393	7.17e-12	SMART
CUB	3395	3507	2.49e-29	SMART
CUB	3511	3623	2.4e-22	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000195447

Meta Mutation Damage Score

0.1659

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.1%
20x: 91.7%

Validation Efficiency

100% (100/100)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Cubilin (CUBN) acts as a receptor for intrinsic factor-vitamin B12 complexes. The role of receptor is supported by the presence of 27 CUB domains. Cubulin is located within the epithelium of intestine and kidney. Mutations in CUBN may play a role in autosomal recessive megaloblastic anemia. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation display embryonic lethality during organogenesis, yolk sac and allantoic vasculature defects, embryonic and visceral endoderm defects, and lack somites. Heterozygotes display incomplete penetrance of premature death. [provided by MGI curators]

Allele List at MGI

All alleles(4) : Targeted, other(1) Gene trapped(3)

Other mutations in this stock

Total: 95 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700034J05Rik	T	A	6: 146,952,404	M252L	probably benign	Het
Abca6	A	G	11: 110,236,789	V314A	probably benign	Het
Abcb1b	A	T	5: 8,827,409	E656D	probably benign	Het
Abhd4	T	C	14: 54,263,234	I160T	probably benign	Het
Aco2	T	C	15: 81,889,356	V32A	probably damaging	Het
Actl6b	A	G	5: 137,554,144		probably benign	Het
Akap13	T	C	7: 75,736,604		probably benign	Het
Alpk3	A	T	7: 81,076,974	T136S	probably benign	Het
Ap1g1	G	T	8: 109,803,117	M56I	probably benign	Het
Arid2	C	T	15: 96,370,571	T855I	probably damaging	Het
Asprv1	T	C	6: 86,629,095	F308L	probably damaging	Het
Ass1	A	T	2: 31,514,819	N371Y	probably damaging	Het
Atp11b	T	A	3: 35,812,110	M378K	possibly damaging	Het
Atp1a3	T	C	7: 24,981,512		probably benign	Het
Blk	C	A	14: 63,380,804	A218S	probably benign	Het
C4b	T	A	17: 34,734,776	T953S	probably benign	Het
Cdadc1	T	C	14: 59,575,907		probably benign	Het
Cdca2	C	A	14: 67,677,178	L877F	probably damaging	Het
Ceacam10	G	T	7: 24,778,308	V83L	probably damaging	Het
Cep290	A	T	10: 100,514,574	I677F	probably benign	Het
Clip1	A	T	5: 123,617,332		probably benign	Het
Col11a2	G	T	17: 34,064,803		probably benign	Het
Coro1c	A	T	5: 113,845,252	V405D	probably benign	Het
Crebrf	A	G	17: 26,739,594	T13A	probably benign	Het
Cspg4	A	G	9: 56,897,410	E1835G	probably damaging	Het
Efnb1	T	C	X: 99,137,028		probably benign	Het
Elf2	G	T	3: 51,308,190	P33Q	probably damaging	Het
Fap	C	T	2: 62,503,402	G633D	probably damaging	Het
Gm10288	T	C	3: 146,838,920		noncoding transcript	Het
Gm14139	G	A	2: 150,191,864	R35K	possibly damaging	Het
Gm7714	A	T	5: 88,282,371	H42L	possibly damaging	Het
Got2	T	C	8: 95,869,538	N318S	probably benign	Het
Guk1	A	T	11: 59,186,028	F76L	probably damaging	Het
H2-K1	A	T	17: 33,996,665		probably benign	Het
Helz2	C	A	2: 181,232,759	G1981C	probably damaging	Het
Hinfp	G	A	9: 44,298,239	H250Y	probably damaging	Het
Hnrnpm	C	T	17: 33,652,268		probably null	Het
Hsd11b2	T	A	8: 105,523,067	V270E	possibly damaging	Het
Igbp1b	A	T	6: 138,658,203	M81K	probably damaging	Het
Kif11	A	G	19: 37,411,509	T815A	probably benign	Het
Kit	G	A	5: 75,620,921	V337I	probably benign	Het
Klf11	T	C	12: 24,653,583	S6P	probably damaging	Het
Klk13	T	C	7: 43,723,821	V193A	probably benign	Het
Krt73	T	A	15: 101,799,889		probably benign	Het
L1td1	T	A	4: 98,737,182	L538*	probably null	Het
Macf1	A	G	4: 123,432,779	L2061P	probably damaging	Het
Mcm2	A	G	6: 88,884,016	I900T	probably damaging	Het
Med16	A	T	10: 79,900,200	N371K	possibly damaging	Het
Mepce	A	C	5: 137,785,436	D209E	possibly damaging	Het
Mrc2	C	G	11: 105,347,866	P1249R	probably benign	Het
Mx2	A	T	16: 97,556,095	I463L	probably benign	Het
Naaa	A	T	5: 92,265,135	N73K	probably damaging	Het
Nags	T	A	11: 102,147,945	L404Q	probably damaging	Het
Neb	A	G	2: 52,243,390	Y3379H	probably damaging	Het
Nhsl1	A	G	10: 18,472,985	E120G	probably damaging	Het
Olfr1276	A	C	2: 111,257,121	N2T	probably benign	Het
Olfr561	C	A	7: 102,774,869	S115*	probably null	Het
Olfr615	T	A	7: 103,560,622	Y48*	probably null	Het
Olfr643	T	C	7: 104,059,521	H27R	probably benign	Het
Olfr736	T	C	14: 50,393,079	S108P	probably damaging	Het
Pcnt	A	G	10: 76,392,580	F1584L	probably benign	Het
Pdgfra	G	A	5: 75,167,935	V243I	probably damaging	Het
Polr2a	T	C	11: 69,743,671	I689V	possibly damaging	Het
Ppfia4	C	A	1: 134,324,224		probably benign	Het
Prmt8	C	A	6: 127,711,808	V200L	probably damaging	Het
Prpf8	T	A	11: 75,506,362	I2007N	possibly damaging	Het
Ptpn6	T	C	6: 124,728,150	E230G	probably damaging	Het
R3hcc1l	G	A	19: 42,563,148	V195I	probably damaging	Het
Rb1cc1	C	T	1: 6,262,847	T1330I	probably damaging	Het
Reep3	G	T	10: 67,021,796	T172N	probably benign	Het
Rfwd3	A	G	8: 111,294,023	V236A	probably benign	Het
Rgs22	T	C	15: 36,104,552	I121V	probably damaging	Het
Robo1	T	A	16: 72,664,170	F11I	probably benign	Het
Rsrc2	A	G	5: 123,740,847		probably benign	Het
Rubcn	A	G	16: 32,847,946	V117A	probably benign	Het
Scamp1	T	G	13: 94,210,580	N192T	probably benign	Het
Scn8a	T	A	15: 101,018,364	I1218N	probably damaging	Het
Serinc1	A	G	10: 57,523,208	S200P	probably damaging	Het
Serpinb9f	T	A	13: 33,334,591	F358Y	probably damaging	Het
Slc12a5	T	C	2: 164,997,245		probably null	Het
Slc5a4b	T	C	10: 76,070,628	M386V	possibly damaging	Het
Smarca5	A	G	8: 80,704,700	F963L	probably benign	Het
Smchd1	A	T	17: 71,411,891	F828I	probably benign	Het
Stab2	G	T	10: 86,897,960	Q1333K	probably benign	Het
Svop	T	C	5: 114,038,539	S349G	probably benign	Het
Tdrd1	G	A	19: 56,842,566	S271N	probably benign	Het
Tec	T	C	5: 72,763,556		probably benign	Het
Tec	G	A	5: 72,783,738	P159S	probably benign	Het
Tfip11	G	A	5: 112,335,655	M645I	probably benign	Het
Thap12	A	T	7: 98,715,281	T219S	probably benign	Het
Tmem87a	C	T	2: 120,375,507	R329H	probably damaging	Het
Tpsab1	A	G	17: 25,343,745	Y227H	probably damaging	Het
Urah	G	A	7: 140,837,689	V114I	probably benign	Het
Wnt5a	G	A	14: 28,522,854	E353K	probably damaging	Het
Zfp101	A	T	17: 33,380,978	H601Q	possibly damaging	Het

Other mutations in Cubn

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00095:Cubn	APN	2	13491820	unclassified	probably benign
IGL00228:Cubn	APN	2	13456697	missense	probably damaging	1.00
IGL00231:Cubn	APN	2	13381849	missense	possibly damaging	0.89
IGL00327:Cubn	APN	2	13427056	missense	possibly damaging	0.73
IGL00470:Cubn	APN	2	13278418	missense	probably benign	0.00
IGL00519:Cubn	APN	2	13282919	missense	probably benign	0.00
IGL00562:Cubn	APN	2	13294230	missense	probably benign	0.01
IGL00678:Cubn	APN	2	13467710	missense	possibly damaging	0.47
IGL00834:Cubn	APN	2	13381927	missense	probably damaging	1.00
IGL00946:Cubn	APN	2	13456623	missense	probably damaging	0.98
IGL00971:Cubn	APN	2	13278408	missense	possibly damaging	0.77
IGL01124:Cubn	APN	2	13478093	missense	possibly damaging	0.62
IGL01287:Cubn	APN	2	13310566	missense	probably damaging	1.00
IGL01410:Cubn	APN	2	13465908	missense	probably benign	0.31
IGL01418:Cubn	APN	2	13284041	missense	probably benign	0.01
IGL01450:Cubn	APN	2	13350862	splice site	probably benign
IGL01534:Cubn	APN	2	13465933	nonsense	probably null
IGL01584:Cubn	APN	2	13308661	splice site	probably benign
IGL01595:Cubn	APN	2	13325216	missense	probably benign	0.05
IGL01625:Cubn	APN	2	13306274	missense	possibly damaging	0.76
IGL01732:Cubn	APN	2	13489936	nonsense	probably null
IGL01972:Cubn	APN	2	13446072	missense	possibly damaging	0.90
IGL02027:Cubn	APN	2	13287594	missense	probably damaging	1.00
IGL02033:Cubn	APN	2	13339846	missense	probably damaging	0.98
IGL02124:Cubn	APN	2	13381837	missense	probably damaging	0.99
IGL02335:Cubn	APN	2	13427834	splice site	probably null
IGL02491:Cubn	APN	2	13321228	missense	probably damaging	1.00
IGL02686:Cubn	APN	2	13325226	missense	possibly damaging	0.92
IGL02707:Cubn	APN	2	13446032	missense	probably damaging	0.99
IGL02746:Cubn	APN	2	13445040	missense	probably damaging	1.00
IGL02873:Cubn	APN	2	13294370	missense	probably benign	0.07
IGL02897:Cubn	APN	2	13318312	missense	possibly damaging	0.55
IGL03078:Cubn	APN	2	13287094	missense	possibly damaging	0.87
IGL03245:Cubn	APN	2	13355689	missense	probably benign	0.09
IGL03289:Cubn	APN	2	13426967	missense	probably benign	0.00
IGL03335:Cubn	APN	2	13360329	missense	probably damaging	1.00
IGL03355:Cubn	APN	2	13478057	splice site	probably null
mellow	UTSW	2	13478078	missense	probably damaging	1.00
PIT4354001:Cubn	UTSW	2	13468852	nonsense	probably null
PIT4495001:Cubn	UTSW	2	13491750	missense	probably benign	0.00
R0145:Cubn	UTSW	2	13306432	missense	probably damaging	1.00
R0220:Cubn	UTSW	2	13356709	missense	probably damaging	1.00
R0254:Cubn	UTSW	2	13424694	missense	probably benign	0.01
R0254:Cubn	UTSW	2	13476035	critical splice donor site	probably null
R0360:Cubn	UTSW	2	13310507	splice site	probably benign
R0364:Cubn	UTSW	2	13310507	splice site	probably benign
R0383:Cubn	UTSW	2	13430959	missense	probably damaging	1.00
R0419:Cubn	UTSW	2	13469763	missense	possibly damaging	0.77
R0419:Cubn	UTSW	2	13469764	missense	possibly damaging	0.87
R0498:Cubn	UTSW	2	13444267	missense	probably damaging	0.99
R0560:Cubn	UTSW	2	13428680	missense	probably damaging	1.00
R0615:Cubn	UTSW	2	13360252	splice site	probably null
R0735:Cubn	UTSW	2	13491689	splice site	probably benign
R0780:Cubn	UTSW	2	13456613	missense	probably damaging	1.00
R0899:Cubn	UTSW	2	13362328	missense	possibly damaging	0.54
R1118:Cubn	UTSW	2	13336242	missense	possibly damaging	0.78
R1182:Cubn	UTSW	2	13445000	missense	probably damaging	0.98
R1439:Cubn	UTSW	2	13287568	missense	probably damaging	0.96
R1450:Cubn	UTSW	2	13360319	missense	probably damaging	1.00
R1464:Cubn	UTSW	2	13325288	missense	possibly damaging	0.87
R1464:Cubn	UTSW	2	13325288	missense	possibly damaging	0.87
R1476:Cubn	UTSW	2	13476120	missense	probably benign	0.04
R1508:Cubn	UTSW	2	13427105	missense	probably benign	0.25
R1532:Cubn	UTSW	2	13287661	missense	probably damaging	1.00
R1562:Cubn	UTSW	2	13427967	missense	probably damaging	1.00
R1598:Cubn	UTSW	2	13469789	missense	probably benign	0.00
R1761:Cubn	UTSW	2	13489317	critical splice donor site	probably null
R1862:Cubn	UTSW	2	13308561	missense	probably damaging	1.00
R1874:Cubn	UTSW	2	13323002	missense	probably damaging	1.00
R1923:Cubn	UTSW	2	13310526	missense	probably damaging	1.00
R1944:Cubn	UTSW	2	13278538	missense	probably benign	0.01
R1960:Cubn	UTSW	2	13340017	splice site	probably null
R2021:Cubn	UTSW	2	13308549	missense	probably benign	0.09
R2137:Cubn	UTSW	2	13336167	missense	probably benign	0.01
R2138:Cubn	UTSW	2	13444378	missense	probably damaging	0.99
R2139:Cubn	UTSW	2	13336167	missense	probably benign	0.01
R2179:Cubn	UTSW	2	13318242	missense	possibly damaging	0.85
R2328:Cubn	UTSW	2	13404080	nonsense	probably null
R2369:Cubn	UTSW	2	13491217	missense	probably damaging	1.00
R2428:Cubn	UTSW	2	13476150	missense	probably damaging	1.00
R2435:Cubn	UTSW	2	13318272	missense	probably damaging	1.00
R2567:Cubn	UTSW	2	13278356	splice site	probably null
R2850:Cubn	UTSW	2	13322953	missense	probably damaging	1.00
R2853:Cubn	UTSW	2	13430834	missense	probably benign	0.00
R2893:Cubn	UTSW	2	13358139	missense	possibly damaging	0.61
R3107:Cubn	UTSW	2	13362347	missense	possibly damaging	0.73
R3109:Cubn	UTSW	2	13362347	missense	possibly damaging	0.73
R3119:Cubn	UTSW	2	13358162	missense	possibly damaging	0.90
R3405:Cubn	UTSW	2	13333508	missense	probably benign	0.00
R3703:Cubn	UTSW	2	13350943	missense	probably damaging	1.00
R3704:Cubn	UTSW	2	13350943	missense	probably damaging	1.00
R3705:Cubn	UTSW	2	13350943	missense	probably damaging	1.00
R3764:Cubn	UTSW	2	13331585	missense	possibly damaging	0.79
R3792:Cubn	UTSW	2	13427914	missense	probably damaging	1.00
R3802:Cubn	UTSW	2	13360353	missense	probably benign	0.01
R3813:Cubn	UTSW	2	13294325	missense	probably damaging	1.00
R3845:Cubn	UTSW	2	13283008	missense	probably damaging	1.00
R3846:Cubn	UTSW	2	13283008	missense	probably damaging	1.00
R3900:Cubn	UTSW	2	13286980	critical splice donor site	probably null
R3921:Cubn	UTSW	2	13326677	missense	probably damaging	1.00
R4075:Cubn	UTSW	2	13313999	missense	possibly damaging	0.58
R4082:Cubn	UTSW	2	13428563	intron	probably benign
R4405:Cubn	UTSW	2	13466030	missense	probably damaging	1.00
R4615:Cubn	UTSW	2	13428749	missense	probably damaging	1.00
R4629:Cubn	UTSW	2	13313979	splice site	probably null
R4770:Cubn	UTSW	2	13314767	missense	possibly damaging	0.92
R4799:Cubn	UTSW	2	13287024	missense	possibly damaging	0.94
R4799:Cubn	UTSW	2	13351058	missense	probably damaging	1.00
R4812:Cubn	UTSW	2	13459076	missense	probably damaging	1.00
R4825:Cubn	UTSW	2	13325225	missense	probably damaging	1.00
R4934:Cubn	UTSW	2	13489910	missense	probably benign	0.06
R4967:Cubn	UTSW	2	13348045	missense	probably benign	0.01
R5187:Cubn	UTSW	2	13287568	missense	probably damaging	0.96
R5232:Cubn	UTSW	2	13478202	nonsense	probably null
R5305:Cubn	UTSW	2	13388939	missense	probably damaging	1.00
R5506:Cubn	UTSW	2	13491695	splice site	probably null
R5530:Cubn	UTSW	2	13308523	missense	probably damaging	1.00
R5531:Cubn	UTSW	2	13350932	missense	probably benign	0.00
R5737:Cubn	UTSW	2	13388891	missense	probably damaging	1.00
R5886:Cubn	UTSW	2	13320023	splice site	probably benign
R5923:Cubn	UTSW	2	13486078	missense	possibly damaging	0.73
R6032:Cubn	UTSW	2	13325184	missense	probably benign	0.12
R6032:Cubn	UTSW	2	13325184	missense	probably benign	0.12
R6084:Cubn	UTSW	2	13430897	missense	probably damaging	1.00
R6087:Cubn	UTSW	2	13427847	missense	probably damaging	1.00
R6133:Cubn	UTSW	2	13308618	missense	probably benign	0.29
R6181:Cubn	UTSW	2	13349876	missense	probably benign	0.31
R6301:Cubn	UTSW	2	13478078	missense	probably damaging	1.00
R6320:Cubn	UTSW	2	13280195	missense	probably damaging	1.00
R6368:Cubn	UTSW	2	13430995	missense	probably damaging	0.96
R6368:Cubn	UTSW	2	13476123	missense	probably damaging	0.98
R6383:Cubn	UTSW	2	13427835	critical splice donor site	probably null
R6393:Cubn	UTSW	2	13355680	missense	probably benign	0.08
R6408:Cubn	UTSW	2	13294203	missense	probably damaging	1.00
R6470:Cubn	UTSW	2	13322993	missense	possibly damaging	0.87
R6532:Cubn	UTSW	2	13459002	missense	probably benign	0.01
R6599:Cubn	UTSW	2	13310673	missense	possibly damaging	0.95
R6629:Cubn	UTSW	2	13430872	missense	probably damaging	1.00
R6641:Cubn	UTSW	2	13476064	missense	probably damaging	1.00
R6800:Cubn	UTSW	2	13321255	missense	probably damaging	1.00
R6823:Cubn	UTSW	2	13445029	missense	probably benign	0.21
R6847:Cubn	UTSW	2	13444253	critical splice donor site	probably null
R6885:Cubn	UTSW	2	13318278	missense	probably damaging	1.00
R6962:Cubn	UTSW	2	13348029	missense	probably benign	0.03
R6973:Cubn	UTSW	2	13381837	missense	possibly damaging	0.61
R6975:Cubn	UTSW	2	13486789	missense	probably damaging	0.99
R7076:Cubn	UTSW	2	13306280	missense	probably benign	0.00
R7076:Cubn	UTSW	2	13306281	missense	probably benign	0.10
R7086:Cubn	UTSW	2	13319858	missense	probably damaging	0.98
R7162:Cubn	UTSW	2	13342498	missense	probably damaging	0.96
R7203:Cubn	UTSW	2	13351003	missense	probably benign	0.01
R7292:Cubn	UTSW	2	13424739	missense	probably damaging	0.99
R7307:Cubn	UTSW	2	13340332	missense	probably damaging	0.99
R7329:Cubn	UTSW	2	13468771	missense	probably damaging	0.99
R7395:Cubn	UTSW	2	13287064	missense	probably damaging	1.00
R7417:Cubn	UTSW	2	13426967	missense	probably benign	0.00
R7429:Cubn	UTSW	2	13322993	missense	possibly damaging	0.87
R7430:Cubn	UTSW	2	13322993	missense	possibly damaging	0.87
R7443:Cubn	UTSW	2	13455509	missense	probably damaging	1.00
R7699:Cubn	UTSW	2	13348178	missense	probably benign
R7699:Cubn	UTSW	2	13489917	missense	possibly damaging	0.74
R7700:Cubn	UTSW	2	13348178	missense	probably benign
R7700:Cubn	UTSW	2	13489917	missense	possibly damaging	0.74
R7751:Cubn	UTSW	2	13360365	missense	probably damaging	1.00
R7755:Cubn	UTSW	2	13280078	missense	probably benign	0.11
R7759:Cubn	UTSW	2	13348150	missense	probably damaging	1.00
R7903:Cubn	UTSW	2	13468869	missense	probably damaging	0.97
R7921:Cubn	UTSW	2	13424727	missense	probably benign	0.22
R7988:Cubn	UTSW	2	13332355	missense	probably benign	0.43
R8010:Cubn	UTSW	2	13336086	critical splice donor site	probably null
R8020:Cubn	UTSW	2	13479178	missense	probably benign	0.01
R8120:Cubn	UTSW	2	13331660	missense	probably damaging	1.00
R8133:Cubn	UTSW	2	13388848	missense	probably damaging	1.00
R8185:Cubn	UTSW	2	13294318	missense	probably benign	0.11
R8224:Cubn	UTSW	2	13349877	missense	probably benign	0.16
R8289:Cubn	UTSW	2	13486802	missense	probably benign	0.10
R8326:Cubn	UTSW	2	13306463	missense	probably benign	0.01
R8331:Cubn	UTSW	2	13340242	missense	probably damaging	1.00
R8338:Cubn	UTSW	2	13430847	missense	probably benign	0.08
R8341:Cubn	UTSW	2	13428724	missense	probably damaging	1.00
R8358:Cubn	UTSW	2	13325160	missense	probably benign	0.17
R8427:Cubn	UTSW	2	13428756	missense	probably benign	0.00
R8432:Cubn	UTSW	2	13381799	missense	probably benign	0.00
R8441:Cubn	UTSW	2	13427847	missense	probably damaging	1.00
R8442:Cubn	UTSW	2	13314044	missense	probably damaging	1.00
R8520:Cubn	UTSW	2	13308520	critical splice donor site	probably null
R8699:Cubn	UTSW	2	13383959	missense	probably damaging	1.00
R8753:Cubn	UTSW	2	13308566	nonsense	probably null
R8874:Cubn	UTSW	2	13360346	missense	possibly damaging	0.63
R9056:Cubn	UTSW	2	13456655	missense	probably damaging	1.00
R9079:Cubn	UTSW	2	13287103	missense	probably benign	0.02
R9143:Cubn	UTSW	2	13332465	splice site	probably benign
R9261:Cubn	UTSW	2	13278451	missense	probably damaging	1.00
R9338:Cubn	UTSW	2	13381892	missense	probably damaging	1.00
R9342:Cubn	UTSW	2	13458956	missense	probably damaging	0.99
R9603:Cubn	UTSW	2	13287699	missense	probably damaging	1.00
R9614:Cubn	UTSW	2	13478134	missense	probably benign	0.00
R9615:Cubn	UTSW	2	13321180	missense	possibly damaging	0.88
R9616:Cubn	UTSW	2	13314718	missense	probably benign	0.04
R9774:Cubn	UTSW	2	13428719	missense	probably benign
X0018:Cubn	UTSW	2	13458986	missense	probably damaging	1.00
X0022:Cubn	UTSW	2	13476076	missense	probably damaging	1.00
X0026:Cubn	UTSW	2	13342581	missense	probably damaging	1.00
X0063:Cubn	UTSW	2	13322962	missense	probably damaging	1.00
YA93:Cubn	UTSW	2	13383992	missense	probably benign	0.21
Z1088:Cubn	UTSW	2	13294229	missense	probably benign	0.43
Z1176:Cubn	UTSW	2	13381825	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- AAAGGTGGCTGGACAAAAGACTCTC -3'
(R):5'- TCCTGCATGTTAAGGCATTAGGCG -3'

Sequencing Primer
(F):5'- AGCTATGCACTGGATGCTAC -3'
(R):5'- GCGTGCCACACAACTCTTC -3'

Posted On

2013-05-09