Incidental Mutation 'R4620:Olfr876'
ID345248
Institutional Source Beutler Lab
Gene Symbol Olfr876
Ensembl Gene ENSMUSG00000066750
Gene Nameolfactory receptor 876
SynonymsGA_x6K02T2PVTD-31489645-31490577, MOR161-1
MMRRC Submission 042008-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.169) question?
Stock #R4620 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location37803031-37808144 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 37804819 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 303 (T303A)
Ref Sequence ENSEMBL: ENSMUSP00000149930 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086064] [ENSMUST00000213368] [ENSMUST00000215287]
Predicted Effect probably benign
Transcript: ENSMUST00000086064
AA Change: T303A

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000083231
Gene: ENSMUSG00000066750
AA Change: T303A

DomainStartEndE-ValueType
Pfam:7tm_4 30 307 1.6e-47 PFAM
Pfam:7tm_1 40 289 3.2e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213368
AA Change: T303A

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
Predicted Effect probably benign
Transcript: ENSMUST00000215287
AA Change: T303A

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
Meta Mutation Damage Score 0.1201 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 99% (80/81)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310057M21Rik A T 7: 131,343,606 Y433* probably null Het
Apba2 C T 7: 64,714,467 R331C probably damaging Het
Apod T C 16: 31,297,393 D173G probably benign Het
B3gnt5 A T 16: 19,769,882 M284L probably benign Het
Birc6 A C 17: 74,640,150 T2955P probably benign Het
Blvra T C 2: 127,096,965 I287T probably damaging Het
Capn5 T C 7: 98,129,371 Y347C probably damaging Het
Cdcp2 A G 4: 107,106,730 E259G probably damaging Het
Cdh2 A G 18: 16,648,608 V85A probably benign Het
Cdk5rap2 A G 4: 70,266,706 I1169T probably benign Het
Cenpj A G 14: 56,535,454 V1043A probably damaging Het
Cfap54 T A 10: 92,969,757 H1497L probably benign Het
Chat A G 14: 32,453,818 M95T probably damaging Het
Csmd1 T C 8: 16,002,694 probably null Het
Csmd3 T C 15: 47,585,753 E3615G probably benign Het
Cyp2c68 A T 19: 39,712,562 probably null Het
Dll1 C T 17: 15,370,566 A332T probably benign Het
Dmrta1 A T 4: 89,688,784 Q159L probably benign Het
Eci3 A T 13: 34,948,758 M212K probably damaging Het
Eml4 T C 17: 83,461,533 F557L probably benign Het
Fat3 A T 9: 15,996,894 V2604D probably damaging Het
Frem3 T C 8: 80,668,957 V1871A possibly damaging Het
Gart T C 16: 91,625,433 N732S probably damaging Het
Gas2l2 T C 11: 83,423,098 I463V probably benign Het
H2-M3 C A 17: 37,272,419 T257K probably damaging Het
Hdgf A G 3: 87,914,576 N166S possibly damaging Het
Hoxb3 A T 11: 96,345,773 N226Y probably damaging Het
Itgav T C 2: 83,755,902 Y169H probably benign Het
Kalrn T G 16: 34,028,705 I426L probably damaging Het
Kcnh3 G A 15: 99,234,101 V646M probably damaging Het
Kif6 T C 17: 49,901,296 V735A probably benign Het
Krt2 T A 15: 101,817,591 I171F probably damaging Het
Megf8 G A 7: 25,355,098 A1880T possibly damaging Het
Miox A T 15: 89,336,121 Y172F probably benign Het
Myo18a G A 11: 77,817,947 R48H possibly damaging Het
Ndufb7 T C 8: 83,566,858 S14P probably damaging Het
Npepps A T 11: 97,238,244 H371Q probably damaging Het
Olfr596 C T 7: 103,309,958 T79I probably benign Het
Olfr672 T A 7: 104,996,623 I94F probably damaging Het
Olfr976 C T 9: 39,956,909 V9M probably damaging Het
Orc5 A T 5: 22,529,176 D203E probably damaging Het
Pappa A G 4: 65,327,028 T1518A probably benign Het
Pde6a A G 18: 61,262,492 D602G probably damaging Het
Pnliprp2 G A 19: 58,762,286 V136I possibly damaging Het
Postn A C 3: 54,376,993 D627A probably damaging Het
Prpf39 T C 12: 65,042,563 V25A probably benign Het
Pxdc1 A G 13: 34,652,314 I41T probably damaging Het
Rab11fip1 T A 8: 27,154,215 E514V probably damaging Het
Rag1 A T 2: 101,643,680 H372Q probably damaging Het
Ranbp1 A G 16: 18,240,104 probably benign Het
Rexo5 A G 7: 119,827,303 I317V probably benign Het
Rragc A G 4: 123,924,829 Q279R probably damaging Het
Sbf1 A G 15: 89,306,926 S187P probably damaging Het
Senp3 T A 11: 69,677,118 Y432F probably benign Het
Slfn5 G A 11: 82,961,652 C868Y probably damaging Het
Sorcs2 C T 5: 36,037,494 A722T probably benign Het
Sptb A T 12: 76,583,807 C2244* probably null Het
Srbd1 A T 17: 86,109,265 F488L probably benign Het
Sucnr1 A G 3: 60,086,769 I239M possibly damaging Het
Themis2 A G 4: 132,786,022 W298R probably damaging Het
Tmem168 T G 6: 13,594,953 N37T probably benign Het
Tmem62 A G 2: 120,996,364 probably benign Het
Tmprss15 T C 16: 79,021,470 D524G probably damaging Het
Trav5-4 G T 14: 53,704,396 M75I probably benign Het
Trio T A 15: 27,871,171 H620L probably damaging Het
Ubap2 C T 4: 41,233,698 G64E probably damaging Het
Usp32 C A 11: 85,059,127 probably null Het
Wdfy3 A T 5: 101,906,145 F1603Y probably damaging Het
Wdr63 A T 3: 146,042,809 L850Q probably damaging Het
Xpo4 A T 14: 57,630,325 L155Q probably damaging Het
Zbtb21 T C 16: 97,949,892 T1092A possibly damaging Het
Zfp780b A T 7: 27,962,753 Y792* probably null Het
Other mutations in Olfr876
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00973:Olfr876 APN 9 37804782 missense probably damaging 1.00
IGL01330:Olfr876 APN 9 37804220 missense probably damaging 1.00
IGL02105:Olfr876 APN 9 37804595 missense possibly damaging 0.53
IGL02505:Olfr876 APN 9 37804331 missense probably benign 0.08
R1543:Olfr876 UTSW 9 37803947 missense possibly damaging 0.94
R1768:Olfr876 UTSW 9 37804303 missense probably damaging 1.00
R1960:Olfr876 UTSW 9 37803946 missense probably benign 0.01
R2567:Olfr876 UTSW 9 37804213 missense probably damaging 1.00
R3815:Olfr876 UTSW 9 37804169 missense probably benign 0.05
R3816:Olfr876 UTSW 9 37804169 missense probably benign 0.05
R3817:Olfr876 UTSW 9 37804169 missense probably benign 0.05
R3819:Olfr876 UTSW 9 37804169 missense probably benign 0.05
R4364:Olfr876 UTSW 9 37804190 missense probably benign 0.19
R4366:Olfr876 UTSW 9 37804190 missense probably benign 0.19
R5530:Olfr876 UTSW 9 37804807 missense probably benign 0.00
R6199:Olfr876 UTSW 9 37804881 utr 3 prime probably null
R6238:Olfr876 UTSW 9 37804021 missense probably benign 0.26
R6893:Olfr876 UTSW 9 37804845 makesense probably null
R7404:Olfr876 UTSW 9 37803961 missense possibly damaging 0.80
R7806:Olfr876 UTSW 9 37804576 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CTGCAGCTCCCACATGATTG -3'
(R):5'- GGCTGAATGCTGTTCACTGG -3'

Sequencing Primer
(F):5'- CATGATTGTGGTTTGTCTTTTCTTTG -3'
(R):5'- GGCTGGTATCCATGAAAATTTTAGG -3'
Posted On2015-09-25