Incidental Mutation 'R4620:Xpo4'
ID 345266
Institutional Source Beutler Lab
Gene Symbol Xpo4
Ensembl Gene ENSMUSG00000021952
Gene Name exportin 4
Synonyms B430309A01Rik
MMRRC Submission 042008-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.808) question?
Stock # R4620 (G1)
Quality Score 225
Status Validated
Chromosome 14
Chromosomal Location 57814978-57902887 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 57867782 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Glutamine at position 155 (L155Q)
Ref Sequence ENSEMBL: ENSMUSP00000133280 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089482] [ENSMUST00000174152] [ENSMUST00000174545]
AlphaFold Q9ESJ0
Predicted Effect probably damaging
Transcript: ENSMUST00000089482
AA Change: L155Q

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000086909
Gene: ENSMUSG00000021952
AA Change: L155Q

DomainStartEndE-ValueType
Blast:IBN_N 37 103 8e-19 BLAST
low complexity region 165 174 N/A INTRINSIC
low complexity region 459 468 N/A INTRINSIC
low complexity region 506 517 N/A INTRINSIC
low complexity region 911 922 N/A INTRINSIC
Pfam:CRM1_C 954 1144 6.3e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000174152
Predicted Effect probably damaging
Transcript: ENSMUST00000174545
AA Change: L155Q

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000133280
Gene: ENSMUSG00000021952
AA Change: L155Q

DomainStartEndE-ValueType
Blast:IBN_N 37 103 8e-19 BLAST
low complexity region 165 174 N/A INTRINSIC
low complexity region 459 468 N/A INTRINSIC
low complexity region 506 517 N/A INTRINSIC
low complexity region 911 922 N/A INTRINSIC
Pfam:CRM1_C 952 1143 5.2e-9 PFAM
Meta Mutation Damage Score 0.5530 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 99% (80/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] XPO4 belongs to a large family of karyopherins (see MIM 602738) that mediate the transport of proteins and other cargo between the nuclear and cytoplasmic compartments (Lipowsky et al., 2000 [PubMed 10944119]).[supplied by OMIM, Mar 2009]
PHENOTYPE: Mice homozygous for a gene trapped allele appear phenotypically normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310057M21Rik A T 7: 130,945,335 (GRCm39) Y433* probably null Het
Apba2 C T 7: 64,364,215 (GRCm39) R331C probably damaging Het
Apod T C 16: 31,116,211 (GRCm39) D173G probably benign Het
B3gnt5 A T 16: 19,588,632 (GRCm39) M284L probably benign Het
Birc6 A C 17: 74,947,145 (GRCm39) T2955P probably benign Het
Blvra T C 2: 126,938,885 (GRCm39) I287T probably damaging Het
Capn5 T C 7: 97,778,578 (GRCm39) Y347C probably damaging Het
Cdcp2 A G 4: 106,963,927 (GRCm39) E259G probably damaging Het
Cdh2 A G 18: 16,781,665 (GRCm39) V85A probably benign Het
Cdk5rap2 A G 4: 70,184,943 (GRCm39) I1169T probably benign Het
Cenpj A G 14: 56,772,911 (GRCm39) V1043A probably damaging Het
Cfap54 T A 10: 92,805,619 (GRCm39) H1497L probably benign Het
Chat A G 14: 32,175,775 (GRCm39) M95T probably damaging Het
Csmd1 T C 8: 16,052,694 (GRCm39) probably null Het
Csmd3 T C 15: 47,449,149 (GRCm39) E3615G probably benign Het
Cyp2c68 A T 19: 39,701,006 (GRCm39) probably null Het
Dll1 C T 17: 15,590,828 (GRCm39) A332T probably benign Het
Dmrta1 A T 4: 89,577,021 (GRCm39) Q159L probably benign Het
Dnai3 A T 3: 145,748,564 (GRCm39) L850Q probably damaging Het
Eci3 A T 13: 35,132,741 (GRCm39) M212K probably damaging Het
Eml4 T C 17: 83,768,962 (GRCm39) F557L probably benign Het
Fat3 A T 9: 15,908,190 (GRCm39) V2604D probably damaging Het
Frem3 T C 8: 81,395,586 (GRCm39) V1871A possibly damaging Het
Gart T C 16: 91,422,321 (GRCm39) N732S probably damaging Het
Gas2l2 T C 11: 83,313,924 (GRCm39) I463V probably benign Het
H2-M3 C A 17: 37,583,310 (GRCm39) T257K probably damaging Het
Hdgf A G 3: 87,821,883 (GRCm39) N166S possibly damaging Het
Hoxb3 A T 11: 96,236,599 (GRCm39) N226Y probably damaging Het
Itgav T C 2: 83,586,246 (GRCm39) Y169H probably benign Het
Kalrn T G 16: 33,849,075 (GRCm39) I426L probably damaging Het
Kcnh3 G A 15: 99,131,982 (GRCm39) V646M probably damaging Het
Kif6 T C 17: 50,208,324 (GRCm39) V735A probably benign Het
Krt1c T A 15: 101,726,026 (GRCm39) I171F probably damaging Het
Megf8 G A 7: 25,054,523 (GRCm39) A1880T possibly damaging Het
Miox A T 15: 89,220,324 (GRCm39) Y172F probably benign Het
Myo18a G A 11: 77,708,773 (GRCm39) R48H possibly damaging Het
Ndufb7 T C 8: 84,293,487 (GRCm39) S14P probably damaging Het
Npepps A T 11: 97,129,070 (GRCm39) H371Q probably damaging Het
Or10d5j C T 9: 39,868,205 (GRCm39) V9M probably damaging Het
Or52e15 T A 7: 104,645,830 (GRCm39) I94F probably damaging Het
Or52e19 C T 7: 102,959,165 (GRCm39) T79I probably benign Het
Or8b12c A G 9: 37,716,115 (GRCm39) T303A probably benign Het
Orc5 A T 5: 22,734,174 (GRCm39) D203E probably damaging Het
Pappa A G 4: 65,245,265 (GRCm39) T1518A probably benign Het
Pde6a A G 18: 61,395,563 (GRCm39) D602G probably damaging Het
Pnliprp2 G A 19: 58,750,718 (GRCm39) V136I possibly damaging Het
Postn A C 3: 54,284,414 (GRCm39) D627A probably damaging Het
Prpf39 T C 12: 65,089,337 (GRCm39) V25A probably benign Het
Pxdc1 A G 13: 34,836,297 (GRCm39) I41T probably damaging Het
Rab11fip1 T A 8: 27,644,243 (GRCm39) E514V probably damaging Het
Rag1 A T 2: 101,474,025 (GRCm39) H372Q probably damaging Het
Ranbp1 A G 16: 18,057,968 (GRCm39) probably benign Het
Rexo5 A G 7: 119,426,526 (GRCm39) I317V probably benign Het
Rragc A G 4: 123,818,622 (GRCm39) Q279R probably damaging Het
Sbf1 A G 15: 89,191,129 (GRCm39) S187P probably damaging Het
Senp3 T A 11: 69,567,944 (GRCm39) Y432F probably benign Het
Slfn5 G A 11: 82,852,478 (GRCm39) C868Y probably damaging Het
Sorcs2 C T 5: 36,194,838 (GRCm39) A722T probably benign Het
Sptb A T 12: 76,630,581 (GRCm39) C2244* probably null Het
Srbd1 A T 17: 86,416,693 (GRCm39) F488L probably benign Het
Sucnr1 A G 3: 59,994,190 (GRCm39) I239M possibly damaging Het
Themis2 A G 4: 132,513,333 (GRCm39) W298R probably damaging Het
Tmem168 T G 6: 13,594,952 (GRCm39) N37T probably benign Het
Tmem62 A G 2: 120,826,845 (GRCm39) probably benign Het
Tmprss15 T C 16: 78,818,358 (GRCm39) D524G probably damaging Het
Trav5-4 G T 14: 53,941,853 (GRCm39) M75I probably benign Het
Trio T A 15: 27,871,257 (GRCm39) H620L probably damaging Het
Ubap2 C T 4: 41,233,698 (GRCm39) G64E probably damaging Het
Usp32 C A 11: 84,949,953 (GRCm39) probably null Het
Wdfy3 A T 5: 102,054,011 (GRCm39) F1603Y probably damaging Het
Zbtb21 T C 16: 97,751,092 (GRCm39) T1092A possibly damaging Het
Zfp780b A T 7: 27,662,178 (GRCm39) Y792* probably null Het
Other mutations in Xpo4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01944:Xpo4 APN 14 57,841,855 (GRCm39) missense probably benign
IGL02537:Xpo4 APN 14 57,831,290 (GRCm39) missense probably benign
IGL02554:Xpo4 APN 14 57,827,545 (GRCm39) missense probably benign 0.00
IGL02826:Xpo4 APN 14 57,866,877 (GRCm39) missense possibly damaging 0.50
IGL03071:Xpo4 APN 14 57,855,685 (GRCm39) missense possibly damaging 0.66
PIT4131001:Xpo4 UTSW 14 57,822,068 (GRCm39) missense probably null 0.98
R0245:Xpo4 UTSW 14 57,867,697 (GRCm39) missense probably damaging 1.00
R0546:Xpo4 UTSW 14 57,850,731 (GRCm39) missense probably benign 0.07
R0606:Xpo4 UTSW 14 57,875,665 (GRCm39) unclassified probably benign
R0761:Xpo4 UTSW 14 57,850,840 (GRCm39) missense probably damaging 0.99
R1775:Xpo4 UTSW 14 57,841,129 (GRCm39) missense probably benign
R1853:Xpo4 UTSW 14 57,823,364 (GRCm39) missense possibly damaging 0.72
R1923:Xpo4 UTSW 14 57,828,328 (GRCm39) missense probably damaging 0.98
R2007:Xpo4 UTSW 14 57,824,101 (GRCm39) missense probably null 0.19
R2035:Xpo4 UTSW 14 57,823,383 (GRCm39) missense possibly damaging 0.57
R2174:Xpo4 UTSW 14 57,827,547 (GRCm39) missense probably damaging 1.00
R2421:Xpo4 UTSW 14 57,866,960 (GRCm39) missense probably benign 0.00
R2937:Xpo4 UTSW 14 57,841,897 (GRCm39) missense probably benign 0.03
R2938:Xpo4 UTSW 14 57,841,897 (GRCm39) missense probably benign 0.03
R4066:Xpo4 UTSW 14 57,825,511 (GRCm39) missense probably benign 0.07
R4086:Xpo4 UTSW 14 57,880,490 (GRCm39) intron probably benign
R4373:Xpo4 UTSW 14 57,828,479 (GRCm39) nonsense probably null
R4703:Xpo4 UTSW 14 57,827,565 (GRCm39) missense probably benign 0.01
R4755:Xpo4 UTSW 14 57,855,638 (GRCm39) missense probably benign 0.01
R4831:Xpo4 UTSW 14 57,827,559 (GRCm39) missense probably damaging 1.00
R4905:Xpo4 UTSW 14 57,875,746 (GRCm39) missense possibly damaging 0.70
R4943:Xpo4 UTSW 14 57,875,697 (GRCm39) missense possibly damaging 0.68
R5074:Xpo4 UTSW 14 57,822,098 (GRCm39) missense probably benign 0.02
R5279:Xpo4 UTSW 14 57,850,866 (GRCm39) missense probably benign 0.37
R5375:Xpo4 UTSW 14 57,875,764 (GRCm39) missense probably damaging 0.99
R5690:Xpo4 UTSW 14 57,828,446 (GRCm39) missense probably benign 0.03
R5936:Xpo4 UTSW 14 57,880,956 (GRCm39) missense probably benign
R6393:Xpo4 UTSW 14 57,875,770 (GRCm39) missense probably damaging 1.00
R6824:Xpo4 UTSW 14 57,850,860 (GRCm39) missense probably damaging 1.00
R6893:Xpo4 UTSW 14 57,819,767 (GRCm39) missense probably benign
R6923:Xpo4 UTSW 14 57,841,168 (GRCm39) missense probably benign 0.19
R7028:Xpo4 UTSW 14 57,834,508 (GRCm39) missense probably benign 0.22
R7442:Xpo4 UTSW 14 57,867,680 (GRCm39) missense probably benign 0.00
R7469:Xpo4 UTSW 14 57,835,436 (GRCm39) missense probably benign
R7490:Xpo4 UTSW 14 57,840,078 (GRCm39) frame shift probably null
R7622:Xpo4 UTSW 14 57,834,468 (GRCm39) missense possibly damaging 0.94
R7667:Xpo4 UTSW 14 57,827,416 (GRCm39) missense probably damaging 0.97
R7789:Xpo4 UTSW 14 57,850,806 (GRCm39) missense probably benign 0.00
R7895:Xpo4 UTSW 14 57,840,048 (GRCm39) missense probably benign 0.03
R8000:Xpo4 UTSW 14 57,827,403 (GRCm39) missense probably damaging 1.00
R8372:Xpo4 UTSW 14 57,835,341 (GRCm39) critical splice donor site probably null
R8395:Xpo4 UTSW 14 57,885,924 (GRCm39) missense probably benign 0.01
R8420:Xpo4 UTSW 14 57,841,913 (GRCm39) missense probably damaging 0.99
R8836:Xpo4 UTSW 14 57,902,367 (GRCm39) missense probably benign 0.03
R8841:Xpo4 UTSW 14 57,835,413 (GRCm39) missense probably damaging 0.97
R8989:Xpo4 UTSW 14 57,828,475 (GRCm39) missense probably benign 0.00
R9229:Xpo4 UTSW 14 57,851,156 (GRCm39) missense probably benign
R9374:Xpo4 UTSW 14 57,828,512 (GRCm39) missense possibly damaging 0.94
R9551:Xpo4 UTSW 14 57,828,512 (GRCm39) missense possibly damaging 0.94
R9628:Xpo4 UTSW 14 57,842,630 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCAGGCATAAGCTACCACTC -3'
(R):5'- ATGTCAGCATTTTCCACACTACTTG -3'

Sequencing Primer
(F):5'- CAAATGCTCTCATCATTGGGAAC -3'
(R):5'- TACTTGAAAAGGAGAGCCAGTCTTC -3'
Posted On 2015-09-25