Incidental Mutation 'R4620:Kcnh3'
ID345271
Institutional Source Beutler Lab
Gene Symbol Kcnh3
Ensembl Gene ENSMUSG00000037579
Gene Namepotassium voltage-gated channel, subfamily H (eag-related), member 3
SynonymsElk2, Melk2, C030044P22Rik, ether a go-go like
MMRRC Submission 042008-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4620 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location99224861-99242817 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 99234101 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 646 (V646M)
Ref Sequence ENSEMBL: ENSMUSP00000040548 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041415]
Predicted Effect probably damaging
Transcript: ENSMUST00000041415
AA Change: V646M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000040548
Gene: ENSMUSG00000037579
AA Change: V646M

DomainStartEndE-ValueType
PAS 20 88 3.94e0 SMART
PAC 94 136 9.92e-6 SMART
low complexity region 148 159 N/A INTRINSIC
Pfam:Ion_trans 224 523 3.8e-34 PFAM
Pfam:Ion_trans_2 453 517 1e-12 PFAM
cNMP 593 708 2.04e-16 SMART
low complexity region 781 800 N/A INTRINSIC
low complexity region 857 872 N/A INTRINSIC
coiled coil region 886 918 N/A INTRINSIC
low complexity region 977 993 N/A INTRINSIC
low complexity region 1022 1035 N/A INTRINSIC
low complexity region 1054 1062 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230552
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230973
Meta Mutation Damage Score 0.198 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 99% (80/81)
MGI Phenotype FUNCTION: The protein encoded by this gene is a voltage-gated potassium channel alpha subunit predominantly expressed in the forebrain. An increase in cognitive function was observed when this gene was knocked out, while deletion of the gene resulted in hippocampal hyperexcitability and epilepsy. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal long term object recognition memory, spatial reference memory, spatial working memory, and long term potentiation. Mice homozygous for a different knock-out allele exhibit neuron hyperexcitability and seizures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310057M21Rik A T 7: 131,343,606 Y433* probably null Het
Apba2 C T 7: 64,714,467 R331C probably damaging Het
Apod T C 16: 31,297,393 D173G probably benign Het
B3gnt5 A T 16: 19,769,882 M284L probably benign Het
Birc6 A C 17: 74,640,150 T2955P probably benign Het
Blvra T C 2: 127,096,965 I287T probably damaging Het
Capn5 T C 7: 98,129,371 Y347C probably damaging Het
Cdcp2 A G 4: 107,106,730 E259G probably damaging Het
Cdh2 A G 18: 16,648,608 V85A probably benign Het
Cdk5rap2 A G 4: 70,266,706 I1169T probably benign Het
Cenpj A G 14: 56,535,454 V1043A probably damaging Het
Cfap54 T A 10: 92,969,757 H1497L probably benign Het
Chat A G 14: 32,453,818 M95T probably damaging Het
Csmd1 T C 8: 16,002,694 probably null Het
Csmd3 T C 15: 47,585,753 E3615G probably benign Het
Cyp2c68 A T 19: 39,712,562 probably null Het
Dll1 C T 17: 15,370,566 A332T probably benign Het
Dmrta1 A T 4: 89,688,784 Q159L probably benign Het
Eci3 A T 13: 34,948,758 M212K probably damaging Het
Eml4 T C 17: 83,461,533 F557L probably benign Het
Fat3 A T 9: 15,996,894 V2604D probably damaging Het
Frem3 T C 8: 80,668,957 V1871A possibly damaging Het
Gart T C 16: 91,625,433 N732S probably damaging Het
Gas2l2 T C 11: 83,423,098 I463V probably benign Het
H2-M3 C A 17: 37,272,419 T257K probably damaging Het
Hdgf A G 3: 87,914,576 N166S possibly damaging Het
Hoxb3 A T 11: 96,345,773 N226Y probably damaging Het
Itgav T C 2: 83,755,902 Y169H probably benign Het
Kalrn T G 16: 34,028,705 I426L probably damaging Het
Kif6 T C 17: 49,901,296 V735A probably benign Het
Krt2 T A 15: 101,817,591 I171F probably damaging Het
Megf8 G A 7: 25,355,098 A1880T possibly damaging Het
Miox A T 15: 89,336,121 Y172F probably benign Het
Myo18a G A 11: 77,817,947 R48H possibly damaging Het
Ndufb7 T C 8: 83,566,858 S14P probably damaging Het
Npepps A T 11: 97,238,244 H371Q probably damaging Het
Olfr596 C T 7: 103,309,958 T79I probably benign Het
Olfr672 T A 7: 104,996,623 I94F probably damaging Het
Olfr876 A G 9: 37,804,819 T303A probably benign Het
Olfr976 C T 9: 39,956,909 V9M probably damaging Het
Orc5 A T 5: 22,529,176 D203E probably damaging Het
Pappa A G 4: 65,327,028 T1518A probably benign Het
Pde6a A G 18: 61,262,492 D602G probably damaging Het
Pnliprp2 G A 19: 58,762,286 V136I possibly damaging Het
Postn A C 3: 54,376,993 D627A probably damaging Het
Prpf39 T C 12: 65,042,563 V25A probably benign Het
Pxdc1 A G 13: 34,652,314 I41T probably damaging Het
Rab11fip1 T A 8: 27,154,215 E514V probably damaging Het
Rag1 A T 2: 101,643,680 H372Q probably damaging Het
Ranbp1 A G 16: 18,240,104 probably benign Het
Rexo5 A G 7: 119,827,303 I317V probably benign Het
Rragc A G 4: 123,924,829 Q279R probably damaging Het
Sbf1 A G 15: 89,306,926 S187P probably damaging Het
Senp3 T A 11: 69,677,118 Y432F probably benign Het
Slfn5 G A 11: 82,961,652 C868Y probably damaging Het
Sorcs2 C T 5: 36,037,494 A722T probably benign Het
Sptb A T 12: 76,583,807 C2244* probably null Het
Srbd1 A T 17: 86,109,265 F488L probably benign Het
Sucnr1 A G 3: 60,086,769 I239M possibly damaging Het
Themis2 A G 4: 132,786,022 W298R probably damaging Het
Tmem168 T G 6: 13,594,953 N37T probably benign Het
Tmem62 A G 2: 120,996,364 probably benign Het
Tmprss15 T C 16: 79,021,470 D524G probably damaging Het
Trav5-4 G T 14: 53,704,396 M75I probably benign Het
Trio T A 15: 27,871,171 H620L probably damaging Het
Ubap2 C T 4: 41,233,698 G64E probably damaging Het
Usp32 C A 11: 85,059,127 probably null Het
Wdfy3 A T 5: 101,906,145 F1603Y probably damaging Het
Wdr63 A T 3: 146,042,809 L850Q probably damaging Het
Xpo4 A T 14: 57,630,325 L155Q probably damaging Het
Zbtb21 T C 16: 97,949,892 T1092A possibly damaging Het
Zfp780b A T 7: 27,962,753 Y792* probably null Het
Other mutations in Kcnh3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00155:Kcnh3 APN 15 99242473 missense possibly damaging 0.85
IGL00911:Kcnh3 APN 15 99233001 nonsense probably null
IGL01099:Kcnh3 APN 15 99239736 missense probably benign 0.02
IGL01350:Kcnh3 APN 15 99241992 missense probably benign
IGL01375:Kcnh3 APN 15 99226993 nonsense probably null
IGL01611:Kcnh3 APN 15 99229502 missense probably benign 0.04
IGL01920:Kcnh3 APN 15 99233377 missense probably benign 0.16
IGL02282:Kcnh3 APN 15 99228043 critical splice donor site probably null
IGL02581:Kcnh3 APN 15 99238171 missense possibly damaging 0.72
IGL02889:Kcnh3 APN 15 99227110 missense probably null 0.82
R0427:Kcnh3 UTSW 15 99233299 missense probably benign 0.22
R0532:Kcnh3 UTSW 15 99232963 missense probably damaging 1.00
R0538:Kcnh3 UTSW 15 99240958 missense probably benign 0.00
R0552:Kcnh3 UTSW 15 99229456 missense probably damaging 1.00
R1235:Kcnh3 UTSW 15 99242103 unclassified probably null
R1290:Kcnh3 UTSW 15 99227120 splice site probably null
R1499:Kcnh3 UTSW 15 99239915 missense probably benign 0.00
R1517:Kcnh3 UTSW 15 99238209 missense probably damaging 1.00
R1706:Kcnh3 UTSW 15 99238078 missense possibly damaging 0.86
R1973:Kcnh3 UTSW 15 99229400 missense probably damaging 1.00
R2285:Kcnh3 UTSW 15 99241992 missense probably benign
R3196:Kcnh3 UTSW 15 99233981 missense probably damaging 1.00
R3716:Kcnh3 UTSW 15 99232765 missense possibly damaging 0.52
R4619:Kcnh3 UTSW 15 99234101 missense probably damaging 1.00
R4624:Kcnh3 UTSW 15 99226372 missense probably damaging 1.00
R4701:Kcnh3 UTSW 15 99241945 missense probably benign
R4853:Kcnh3 UTSW 15 99242089 missense possibly damaging 0.56
R4869:Kcnh3 UTSW 15 99242032 missense probably benign 0.06
R4991:Kcnh3 UTSW 15 99232756 missense probably benign 0.00
R5004:Kcnh3 UTSW 15 99226502 nonsense probably null
R5296:Kcnh3 UTSW 15 99241939 missense probably null 0.92
R5317:Kcnh3 UTSW 15 99227941 missense probably benign
R5338:Kcnh3 UTSW 15 99242394 nonsense probably null
R5658:Kcnh3 UTSW 15 99242076 missense possibly damaging 0.77
R5794:Kcnh3 UTSW 15 99232974 missense probably benign 0.01
R5934:Kcnh3 UTSW 15 99226533 missense possibly damaging 0.46
R6303:Kcnh3 UTSW 15 99227038 missense probably benign 0.37
R6304:Kcnh3 UTSW 15 99227038 missense probably benign 0.37
R6385:Kcnh3 UTSW 15 99227941 missense probably benign
R6466:Kcnh3 UTSW 15 99238243 missense probably damaging 1.00
R6640:Kcnh3 UTSW 15 99241768 missense probably benign 0.08
R6879:Kcnh3 UTSW 15 99238167 missense probably damaging 1.00
R6984:Kcnh3 UTSW 15 99228552 missense probably benign 0.00
X0028:Kcnh3 UTSW 15 99242100 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ATGAGCTTCGTGCAGACATCG -3'
(R):5'- GGCTCATCTTTGAACTTTGTCTAGAG -3'

Sequencing Primer
(F):5'- TTCGTGCAGACATCGCCATG -3'
(R):5'- AACTTTGTCTAGAGCTCTGGC -3'
Posted On2015-09-25