Mutagenetix > Incidental Mutation

Incidental Mutation 'R4620:Kalrn'

345277

Institutional Source

Beutler Lab

Gene Symbol

Kalrn

Ensembl Gene

ENSMUSG00000061751

Gene Name

kalirin, RhoGEF kinase

Synonyms

2210407G14Rik, Hapip, E530005C20Rik, LOC224126

MMRRC Submission

042008-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.922) question?

Stock #

R4620 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

33969073-34573532 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 34028705 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Leucine at position 426 (I426L)

Ref Sequence

ENSEMBL: ENSMUSP00000110615 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000076810] [ENSMUST00000114963] [ENSMUST00000114964] [ENSMUST00000114966] [ENSMUST00000114973] [ENSMUST00000232157]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000076810
AA Change: I2126L

PolyPhen 2 Score 0.467 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000076088
Gene: ENSMUSG00000061751
AA Change: I2126L

Domain	Start	End	E-Value	Type
SEC14	20	159	2.22e-30	SMART
SPEC	173	289	5.32e-9	SMART
SPEC	295	397	1.19e-11	SMART
SPEC	400	515	1.83e0	SMART
SPEC	521	623	9.84e-13	SMART
SPEC	626	748	2.74e-2	SMART
SPEC	875	976	8.11e-14	SMART
SPEC	1106	1208	4.7e-10	SMART
RhoGEF	1258	1428	3.6e-56	SMART
PH	1442	1555	5.24e-8	SMART
SH3	1622	1683	1.23e-7	SMART
RhoGEF	1904	2074	1.47e-52	SMART
PH	2094	2199	9.87e-4	SMART
SH3	2295	2356	2.78e-2	SMART
IGc2	2455	2527	4.28e-12	SMART
FN3	2541	2623	3.07e-11	SMART
S_TKc	2656	2910	1.28e-71	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000114963
AA Change: I495L

PolyPhen 2 Score 0.918 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000110614
Gene: ENSMUSG00000061751
AA Change: I495L

Domain	Start	End	E-Value	Type
SH3	22	83	1.23e-7	SMART
RhoGEF	273	443	1.47e-52	SMART
PH	463	568	9.87e-4	SMART
SH3	664	725	2.78e-2	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000114964
AA Change: I426L

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000110615
Gene: ENSMUSG00000061751
AA Change: I426L

Domain	Start	End	E-Value	Type
RhoGEF	204	374	1.47e-52	SMART
PH	394	499	9.87e-4	SMART
SH3	595	656	2.78e-2	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000114966
AA Change: I457L

PolyPhen 2 Score 0.918 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000110617
Gene: ENSMUSG00000061751
AA Change: I457L

Domain	Start	End	E-Value	Type
RhoGEF	235	405	1.47e-52	SMART
PH	425	530	9.87e-4	SMART
SH3	626	687	2.78e-2	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000114973
AA Change: I457L

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000110624
Gene: ENSMUSG00000061751
AA Change: I457L

Domain	Start	End	E-Value	Type
RhoGEF	235	405	1.47e-52	SMART
PH	425	530	9.87e-4	SMART
SH3	626	687	2.78e-2	SMART
IGc2	786	858	4.28e-12	SMART
FN3	872	954	3.07e-11	SMART
S_TKc	987	1241	1.28e-71	SMART

Predicted Effect

unknown
Transcript: ENSMUST00000142817
AA Change: I2121L

SMART Domains

Protein: ENSMUSP00000116188
Gene: ENSMUSG00000061751
AA Change: I2121L

Domain	Start	End	E-Value	Type
SEC14	16	155	2.22e-30	SMART
SPEC	169	285	5.32e-9	SMART
SPEC	291	393	1.19e-11	SMART
SPEC	396	511	1.83e0	SMART
SPEC	517	619	9.84e-13	SMART
SPEC	622	744	2.74e-2	SMART
SPEC	871	972	8.11e-14	SMART
SPEC	1102	1204	4.7e-10	SMART
RhoGEF	1254	1424	3.6e-56	SMART
PH	1438	1551	5.24e-8	SMART
SH3	1618	1679	1.23e-7	SMART
RhoGEF	1900	2070	1.47e-52	SMART
PH	2090	2195	9.87e-4	SMART
SH3	2291	2352	2.78e-2	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000232157
AA Change: I426L

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)

Meta Mutation Damage Score

0.2224

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.2%
20x: 95.1%

Validation Efficiency

99% (80/81)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Huntington's disease (HD), a neurodegenerative disorder characterized by loss of striatal neurons, is caused by an expansion of a polyglutamine tract in the HD protein huntingtin. This gene encodes a protein that interacts with the huntingtin-associated protein 1, which is a huntingtin binding protein that may function in vesicle trafficking. [provided by RefSeq, Apr 2016]
PHENOTYPE: Mice homozygous for a knock-out allele specific for isoform 7 exhibit decreased anxiety-related behavior, contextual conditioning, and synapse formation. Mice homozygous for another knock-out allele exhibit impaired AMPA-mediated synaptic currents and abnormal behavior. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 72 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310057M21Rik	A	T	7: 131,343,606 (GRCm38)	Y433*	probably null	Het
Apba2	C	T	7: 64,714,467 (GRCm38)	R331C	probably damaging	Het
Apod	T	C	16: 31,297,393 (GRCm38)	D173G	probably benign	Het
B3gnt5	A	T	16: 19,769,882 (GRCm38)	M284L	probably benign	Het
Birc6	A	C	17: 74,640,150 (GRCm38)	T2955P	probably benign	Het
Blvra	T	C	2: 127,096,965 (GRCm38)	I287T	probably damaging	Het
Capn5	T	C	7: 98,129,371 (GRCm38)	Y347C	probably damaging	Het
Cdcp2	A	G	4: 107,106,730 (GRCm38)	E259G	probably damaging	Het
Cdh2	A	G	18: 16,648,608 (GRCm38)	V85A	probably benign	Het
Cdk5rap2	A	G	4: 70,266,706 (GRCm38)	I1169T	probably benign	Het
Cenpj	A	G	14: 56,535,454 (GRCm38)	V1043A	probably damaging	Het
Cfap54	T	A	10: 92,969,757 (GRCm38)	H1497L	probably benign	Het
Chat	A	G	14: 32,453,818 (GRCm38)	M95T	probably damaging	Het
Csmd1	T	C	8: 16,002,694 (GRCm38)		probably null	Het
Csmd3	T	C	15: 47,585,753 (GRCm38)	E3615G	probably benign	Het
Cyp2c68	A	T	19: 39,712,562 (GRCm38)		probably null	Het
Dll1	C	T	17: 15,370,566 (GRCm38)	A332T	probably benign	Het
Dmrta1	A	T	4: 89,688,784 (GRCm38)	Q159L	probably benign	Het
Dnai3	A	T	3: 146,042,809 (GRCm38)	L850Q	probably damaging	Het
Eci3	A	T	13: 34,948,758 (GRCm38)	M212K	probably damaging	Het
Eml4	T	C	17: 83,461,533 (GRCm38)	F557L	probably benign	Het
Fat3	A	T	9: 15,996,894 (GRCm38)	V2604D	probably damaging	Het
Frem3	T	C	8: 80,668,957 (GRCm38)	V1871A	possibly damaging	Het
Gart	T	C	16: 91,625,433 (GRCm38)	N732S	probably damaging	Het
Gas2l2	T	C	11: 83,423,098 (GRCm38)	I463V	probably benign	Het
H2-M3	C	A	17: 37,272,419 (GRCm38)	T257K	probably damaging	Het
Hdgf	A	G	3: 87,914,576 (GRCm38)	N166S	possibly damaging	Het
Hoxb3	A	T	11: 96,345,773 (GRCm38)	N226Y	probably damaging	Het
Itgav	T	C	2: 83,755,902 (GRCm38)	Y169H	probably benign	Het
Kcnh3	G	A	15: 99,234,101 (GRCm38)	V646M	probably damaging	Het
Kif6	T	C	17: 49,901,296 (GRCm38)	V735A	probably benign	Het
Krt2	T	A	15: 101,817,591 (GRCm38)	I171F	probably damaging	Het
Megf8	G	A	7: 25,355,098 (GRCm38)	A1880T	possibly damaging	Het
Miox	A	T	15: 89,336,121 (GRCm38)	Y172F	probably benign	Het
Myo18a	G	A	11: 77,817,947 (GRCm38)	R48H	possibly damaging	Het
Ndufb7	T	C	8: 83,566,858 (GRCm38)	S14P	probably damaging	Het
Npepps	A	T	11: 97,238,244 (GRCm38)	H371Q	probably damaging	Het
Or10d5j	C	T	9: 39,956,909 (GRCm38)	V9M	probably damaging	Het
Or52e15	T	A	7: 104,996,623 (GRCm38)	I94F	probably damaging	Het
Or52e19	C	T	7: 103,309,958 (GRCm38)	T79I	probably benign	Het
Or8b12c	A	G	9: 37,804,819 (GRCm38)	T303A	probably benign	Het
Orc5	A	T	5: 22,529,176 (GRCm38)	D203E	probably damaging	Het
Pappa	A	G	4: 65,327,028 (GRCm38)	T1518A	probably benign	Het
Pde6a	A	G	18: 61,262,492 (GRCm38)	D602G	probably damaging	Het
Pnliprp2	G	A	19: 58,762,286 (GRCm38)	V136I	possibly damaging	Het
Postn	A	C	3: 54,376,993 (GRCm38)	D627A	probably damaging	Het
Prpf39	T	C	12: 65,042,563 (GRCm38)	V25A	probably benign	Het
Pxdc1	A	G	13: 34,652,314 (GRCm38)	I41T	probably damaging	Het
Rab11fip1	T	A	8: 27,154,215 (GRCm38)	E514V	probably damaging	Het
Rag1	A	T	2: 101,643,680 (GRCm38)	H372Q	probably damaging	Het
Ranbp1	A	G	16: 18,240,104 (GRCm38)		probably benign	Het
Rexo5	A	G	7: 119,827,303 (GRCm38)	I317V	probably benign	Het
Rragc	A	G	4: 123,924,829 (GRCm38)	Q279R	probably damaging	Het
Sbf1	A	G	15: 89,306,926 (GRCm38)	S187P	probably damaging	Het
Senp3	T	A	11: 69,677,118 (GRCm38)	Y432F	probably benign	Het
Slfn5	G	A	11: 82,961,652 (GRCm38)	C868Y	probably damaging	Het
Sorcs2	C	T	5: 36,037,494 (GRCm38)	A722T	probably benign	Het
Sptb	A	T	12: 76,583,807 (GRCm38)	C2244*	probably null	Het
Srbd1	A	T	17: 86,109,265 (GRCm38)	F488L	probably benign	Het
Sucnr1	A	G	3: 60,086,769 (GRCm38)	I239M	possibly damaging	Het
Themis2	A	G	4: 132,786,022 (GRCm38)	W298R	probably damaging	Het
Tmem168	T	G	6: 13,594,953 (GRCm38)	N37T	probably benign	Het
Tmem62	A	G	2: 120,996,364 (GRCm38)		probably benign	Het
Tmprss15	T	C	16: 79,021,470 (GRCm38)	D524G	probably damaging	Het
Trav5-4	G	T	14: 53,704,396 (GRCm38)	M75I	probably benign	Het
Trio	T	A	15: 27,871,171 (GRCm38)	H620L	probably damaging	Het
Ubap2	C	T	4: 41,233,698 (GRCm38)	G64E	probably damaging	Het
Usp32	C	A	11: 85,059,127 (GRCm38)		probably null	Het
Wdfy3	A	T	5: 101,906,145 (GRCm38)	F1603Y	probably damaging	Het
Xpo4	A	T	14: 57,630,325 (GRCm38)	L155Q	probably damaging	Het
Zbtb21	T	C	16: 97,949,892 (GRCm38)	T1092A	possibly damaging	Het
Zfp780b	A	T	7: 27,962,753 (GRCm38)	Y792*	probably null	Het

Other mutations in Kalrn

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01361:Kalrn	APN	16	34,175,722 (GRCm38)	splice site	probably benign
IGL01364:Kalrn	APN	16	34,262,629 (GRCm38)	missense	probably damaging	1.00
IGL01510:Kalrn	APN	16	34,235,330 (GRCm38)	missense	possibly damaging	0.52
IGL01664:Kalrn	APN	16	34,294,161 (GRCm38)	missense	probably damaging	1.00
IGL01934:Kalrn	APN	16	34,198,512 (GRCm38)	splice site	probably null
IGL02059:Kalrn	APN	16	34,252,341 (GRCm38)	missense	possibly damaging	0.95
IGL02102:Kalrn	APN	16	34,220,222 (GRCm38)	missense	probably damaging	1.00
IGL02306:Kalrn	APN	16	34,310,527 (GRCm38)	missense	probably damaging	0.97
IGL02328:Kalrn	APN	16	34,332,224 (GRCm38)	missense	probably damaging	0.98
IGL02532:Kalrn	APN	16	34,360,846 (GRCm38)	missense	probably damaging	1.00
IGL02685:Kalrn	APN	16	34,513,959 (GRCm38)	nonsense	probably null
IGL02696:Kalrn	APN	16	34,220,114 (GRCm38)	missense	probably damaging	1.00
IGL02708:Kalrn	APN	16	34,392,050 (GRCm38)	missense	probably damaging	1.00
IGL02937:Kalrn	APN	16	34,220,130 (GRCm38)	nonsense	probably null
IGL03188:Kalrn	APN	16	34,314,192 (GRCm38)	missense	probably benign	0.01
IGL03289:Kalrn	APN	16	34,385,297 (GRCm38)	missense	possibly damaging	0.90
IGL03408:Kalrn	APN	16	34,314,176 (GRCm38)	missense	probably damaging	0.99
breeze	UTSW	16	34,013,675 (GRCm38)	missense
ethereal	UTSW	16	33,975,435 (GRCm38)	utr 3 prime	probably benign
Feather	UTSW	16	34,314,209 (GRCm38)	missense	probably damaging	0.99
Hidden	UTSW	16	34,027,976 (GRCm38)	missense	probably damaging	1.00
Soulful	UTSW	16	34,187,484 (GRCm38)	nonsense	probably null
G1Funyon:Kalrn	UTSW	16	34,357,100 (GRCm38)	missense	probably benign	0.05
PIT4498001:Kalrn	UTSW	16	34,031,582 (GRCm38)	missense	possibly damaging	0.81
R0019:Kalrn	UTSW	16	34,198,514 (GRCm38)	splice site	probably benign
R0043:Kalrn	UTSW	16	34,054,906 (GRCm38)	missense	probably damaging	1.00
R0052:Kalrn	UTSW	16	34,357,171 (GRCm38)	missense	probably damaging	1.00
R0066:Kalrn	UTSW	16	34,203,957 (GRCm38)	missense	probably damaging	1.00
R0098:Kalrn	UTSW	16	33,975,619 (GRCm38)	missense	possibly damaging	0.89
R0098:Kalrn	UTSW	16	33,975,619 (GRCm38)	missense	possibly damaging	0.89
R0111:Kalrn	UTSW	16	34,031,590 (GRCm38)	missense	probably damaging	1.00
R0113:Kalrn	UTSW	16	34,049,936 (GRCm38)	intron	probably benign
R0183:Kalrn	UTSW	16	34,171,379 (GRCm38)	splice site	probably null
R0422:Kalrn	UTSW	16	34,314,273 (GRCm38)	missense	probably damaging	0.99
R0498:Kalrn	UTSW	16	34,054,891 (GRCm38)	missense	possibly damaging	0.61
R0614:Kalrn	UTSW	16	33,993,670 (GRCm38)	splice site	probably benign
R0656:Kalrn	UTSW	16	34,032,467 (GRCm38)	missense	probably damaging	1.00
R0671:Kalrn	UTSW	16	34,116,408 (GRCm38)	missense	probably benign	0.04
R0707:Kalrn	UTSW	16	34,010,581 (GRCm38)	missense	possibly damaging	0.88
R0709:Kalrn	UTSW	16	34,035,554 (GRCm38)	missense	probably damaging	1.00
R0834:Kalrn	UTSW	16	34,049,919 (GRCm38)	missense	possibly damaging	0.94
R0976:Kalrn	UTSW	16	34,385,390 (GRCm38)	missense	probably damaging	1.00
R1297:Kalrn	UTSW	16	34,016,498 (GRCm38)	missense	probably damaging	0.99
R1355:Kalrn	UTSW	16	33,975,584 (GRCm38)	missense	possibly damaging	0.74
R1370:Kalrn	UTSW	16	33,975,584 (GRCm38)	missense	possibly damaging	0.74
R1389:Kalrn	UTSW	16	33,988,803 (GRCm38)	missense	probably benign	0.01
R1398:Kalrn	UTSW	16	34,212,820 (GRCm38)	missense	probably damaging	1.00
R1427:Kalrn	UTSW	16	33,975,754 (GRCm38)	missense	probably damaging	1.00
R1458:Kalrn	UTSW	16	34,174,487 (GRCm38)	missense	probably damaging	1.00
R1470:Kalrn	UTSW	16	34,187,471 (GRCm38)	missense	probably damaging	1.00
R1470:Kalrn	UTSW	16	34,187,471 (GRCm38)	missense	probably damaging	1.00
R1557:Kalrn	UTSW	16	34,314,278 (GRCm38)	missense	possibly damaging	0.92
R1559:Kalrn	UTSW	16	34,010,548 (GRCm38)	missense	possibly damaging	0.92
R1654:Kalrn	UTSW	16	33,975,738 (GRCm38)	missense	probably damaging	1.00
R1703:Kalrn	UTSW	16	34,205,326 (GRCm38)	missense	probably damaging	1.00
R1759:Kalrn	UTSW	16	34,360,950 (GRCm38)	missense	probably damaging	0.97
R1764:Kalrn	UTSW	16	34,212,873 (GRCm38)	missense	probably damaging	1.00
R1824:Kalrn	UTSW	16	34,294,215 (GRCm38)	missense	probably damaging	1.00
R1845:Kalrn	UTSW	16	34,356,961 (GRCm38)	missense	probably damaging	0.99
R1850:Kalrn	UTSW	16	33,975,923 (GRCm38)	missense	probably damaging	0.98
R1921:Kalrn	UTSW	16	34,392,093 (GRCm38)	missense	probably benign	0.02
R1922:Kalrn	UTSW	16	34,392,093 (GRCm38)	missense	probably benign	0.02
R1970:Kalrn	UTSW	16	33,977,524 (GRCm38)	critical splice donor site	probably null
R1991:Kalrn	UTSW	16	33,975,738 (GRCm38)	missense	probably damaging	1.00
R1992:Kalrn	UTSW	16	33,975,738 (GRCm38)	missense	probably damaging	1.00
R2001:Kalrn	UTSW	16	34,028,045 (GRCm38)	missense	probably damaging	1.00
R2025:Kalrn	UTSW	16	34,189,736 (GRCm38)	missense	probably damaging	0.96
R2048:Kalrn	UTSW	16	34,252,310 (GRCm38)	missense	probably benign	0.18
R2076:Kalrn	UTSW	16	34,332,143 (GRCm38)	missense	probably benign	0.15
R2118:Kalrn	UTSW	16	34,332,230 (GRCm38)	missense	possibly damaging	0.84
R2136:Kalrn	UTSW	16	34,307,724 (GRCm38)	missense	possibly damaging	0.82
R2145:Kalrn	UTSW	16	34,009,262 (GRCm38)	unclassified	probably benign
R2193:Kalrn	UTSW	16	33,989,810 (GRCm38)	missense	possibly damaging	0.72
R2195:Kalrn	UTSW	16	33,989,810 (GRCm38)	missense	possibly damaging	0.72
R2234:Kalrn	UTSW	16	34,176,262 (GRCm38)	splice site	probably null
R2404:Kalrn	UTSW	16	33,989,810 (GRCm38)	missense	possibly damaging	0.72
R2405:Kalrn	UTSW	16	33,989,810 (GRCm38)	missense	possibly damaging	0.72
R2408:Kalrn	UTSW	16	33,989,810 (GRCm38)	missense	possibly damaging	0.72
R2411:Kalrn	UTSW	16	33,989,810 (GRCm38)	missense	possibly damaging	0.72
R2570:Kalrn	UTSW	16	34,310,495 (GRCm38)	missense	probably damaging	1.00
R2903:Kalrn	UTSW	16	33,989,810 (GRCm38)	missense	possibly damaging	0.72
R2904:Kalrn	UTSW	16	33,989,810 (GRCm38)	missense	possibly damaging	0.72
R2924:Kalrn	UTSW	16	33,989,810 (GRCm38)	missense	possibly damaging	0.72
R3411:Kalrn	UTSW	16	34,212,272 (GRCm38)	missense	probably benign	0.07
R3693:Kalrn	UTSW	16	34,357,315 (GRCm38)	missense	probably damaging	1.00
R3709:Kalrn	UTSW	16	34,392,030 (GRCm38)	splice site	probably null
R3788:Kalrn	UTSW	16	34,220,240 (GRCm38)	missense	probably damaging	1.00
R3833:Kalrn	UTSW	16	34,039,889 (GRCm38)	nonsense	probably null
R3871:Kalrn	UTSW	16	34,203,856 (GRCm38)	splice site	probably null
R3934:Kalrn	UTSW	16	34,310,531 (GRCm38)	missense	probably benign	0.34
R4033:Kalrn	UTSW	16	33,989,810 (GRCm38)	missense	possibly damaging	0.72
R4056:Kalrn	UTSW	16	34,314,209 (GRCm38)	missense	probably damaging	0.99
R4057:Kalrn	UTSW	16	34,314,209 (GRCm38)	missense	probably damaging	0.99
R4303:Kalrn	UTSW	16	34,235,391 (GRCm38)	missense	probably damaging	1.00
R4402:Kalrn	UTSW	16	33,989,810 (GRCm38)	missense	possibly damaging	0.72
R4444:Kalrn	UTSW	16	33,989,810 (GRCm38)	missense	possibly damaging	0.72
R4482:Kalrn	UTSW	16	33,989,810 (GRCm38)	missense	possibly damaging	0.72
R4487:Kalrn	UTSW	16	33,989,810 (GRCm38)	missense	possibly damaging	0.72
R4558:Kalrn	UTSW	16	33,987,208 (GRCm38)	missense	possibly damaging	0.46
R4572:Kalrn	UTSW	16	34,392,042 (GRCm38)	missense	probably damaging	0.98
R4583:Kalrn	UTSW	16	34,235,267 (GRCm38)	missense	probably damaging	1.00
R4604:Kalrn	UTSW	16	34,513,926 (GRCm38)	missense	possibly damaging	0.46
R4651:Kalrn	UTSW	16	34,176,391 (GRCm38)	missense	probably damaging	1.00
R4703:Kalrn	UTSW	16	34,203,957 (GRCm38)	missense	probably damaging	1.00
R4704:Kalrn	UTSW	16	34,203,957 (GRCm38)	missense	probably damaging	1.00
R4705:Kalrn	UTSW	16	34,203,957 (GRCm38)	missense	probably damaging	1.00
R4760:Kalrn	UTSW	16	34,198,487 (GRCm38)	missense	probably damaging	1.00
R4793:Kalrn	UTSW	16	33,989,810 (GRCm38)	missense	possibly damaging	0.72
R4794:Kalrn	UTSW	16	33,989,810 (GRCm38)	missense	possibly damaging	0.72
R4811:Kalrn	UTSW	16	34,356,969 (GRCm38)	missense	probably damaging	1.00
R4816:Kalrn	UTSW	16	34,514,019 (GRCm38)	unclassified	probably benign
R4888:Kalrn	UTSW	16	34,171,330 (GRCm38)	missense	probably damaging	1.00
R4952:Kalrn	UTSW	16	34,357,415 (GRCm38)	splice site	probably null
R5030:Kalrn	UTSW	16	33,975,742 (GRCm38)	missense	probably benign	0.00
R5045:Kalrn	UTSW	16	34,314,352 (GRCm38)	nonsense	probably null
R5117:Kalrn	UTSW	16	34,033,601 (GRCm38)	critical splice acceptor site	probably null
R5289:Kalrn	UTSW	16	34,252,341 (GRCm38)	missense	possibly damaging	0.95
R5426:Kalrn	UTSW	16	34,262,653 (GRCm38)	missense	probably damaging	1.00
R5432:Kalrn	UTSW	16	34,053,622 (GRCm38)	missense	probably damaging	1.00
R5611:Kalrn	UTSW	16	34,175,780 (GRCm38)	missense	probably damaging	1.00
R5629:Kalrn	UTSW	16	34,039,934 (GRCm38)	missense	possibly damaging	0.77
R5635:Kalrn	UTSW	16	34,014,084 (GRCm38)	missense	probably damaging	1.00
R5713:Kalrn	UTSW	16	34,016,579 (GRCm38)	missense	probably benign
R5716:Kalrn	UTSW	16	33,987,176 (GRCm38)	missense	probably benign	0.01
R5772:Kalrn	UTSW	16	33,975,820 (GRCm38)	missense	probably damaging	1.00
R5797:Kalrn	UTSW	16	34,212,249 (GRCm38)	missense	probably damaging	0.98
R5835:Kalrn	UTSW	16	33,987,091 (GRCm38)	missense	probably benign	0.28
R5895:Kalrn	UTSW	16	33,975,435 (GRCm38)	utr 3 prime	probably benign
R5924:Kalrn	UTSW	16	34,243,833 (GRCm38)	missense	probably damaging	1.00
R5999:Kalrn	UTSW	16	34,357,343 (GRCm38)	missense	probably damaging	1.00
R6010:Kalrn	UTSW	16	34,010,580 (GRCm38)	missense	probably benign	0.06
R6052:Kalrn	UTSW	16	34,360,885 (GRCm38)	missense	probably damaging	1.00
R6122:Kalrn	UTSW	16	33,985,191 (GRCm38)	missense	possibly damaging	0.82
R6128:Kalrn	UTSW	16	34,212,885 (GRCm38)	missense	probably damaging	0.99
R6136:Kalrn	UTSW	16	34,357,111 (GRCm38)	missense	probably damaging	1.00
R6178:Kalrn	UTSW	16	34,053,639 (GRCm38)	missense	possibly damaging	0.88
R6229:Kalrn	UTSW	16	34,055,071 (GRCm38)	missense	probably damaging	1.00
R6376:Kalrn	UTSW	16	33,975,991 (GRCm38)	missense	probably benign
R6397:Kalrn	UTSW	16	33,992,985 (GRCm38)	missense	probably damaging	1.00
R6429:Kalrn	UTSW	16	34,332,164 (GRCm38)	missense	possibly damaging	0.85
R6473:Kalrn	UTSW	16	34,205,302 (GRCm38)	missense	probably damaging	1.00
R6481:Kalrn	UTSW	16	34,360,984 (GRCm38)	missense	probably damaging	1.00
R6597:Kalrn	UTSW	16	34,182,747 (GRCm38)	missense	probably damaging	1.00
R6736:Kalrn	UTSW	16	34,217,923 (GRCm38)	missense	probably damaging	1.00
R6808:Kalrn	UTSW	16	34,027,976 (GRCm38)	missense	probably damaging	1.00
R6897:Kalrn	UTSW	16	33,975,703 (GRCm38)	missense	probably damaging	0.99
R6955:Kalrn	UTSW	16	34,220,136 (GRCm38)	missense	probably damaging	1.00
R7060:Kalrn	UTSW	16	34,357,048 (GRCm38)	missense	probably damaging	0.99
R7064:Kalrn	UTSW	16	34,217,891 (GRCm38)	missense	probably damaging	1.00
R7132:Kalrn	UTSW	16	34,256,227 (GRCm38)	missense	unknown
R7154:Kalrn	UTSW	16	34,212,157 (GRCm38)	critical splice donor site	probably null
R7181:Kalrn	UTSW	16	34,163,077 (GRCm38)	missense	probably benign	0.00
R7234:Kalrn	UTSW	16	34,176,422 (GRCm38)	missense	possibly damaging	0.63
R7235:Kalrn	UTSW	16	34,175,761 (GRCm38)	missense	probably benign	0.18
R7504:Kalrn	UTSW	16	34,256,233 (GRCm38)	missense	unknown
R7563:Kalrn	UTSW	16	34,392,094 (GRCm38)	missense	probably damaging	0.97
R7612:Kalrn	UTSW	16	34,314,212 (GRCm38)	missense	possibly damaging	0.68
R7772:Kalrn	UTSW	16	34,031,582 (GRCm38)	missense	probably benign	0.04
R7796:Kalrn	UTSW	16	34,187,484 (GRCm38)	nonsense	probably null
R7867:Kalrn	UTSW	16	33,989,791 (GRCm38)	missense	possibly damaging	0.94
R7869:Kalrn	UTSW	16	33,988,847 (GRCm38)	missense	probably damaging	0.98
R7914:Kalrn	UTSW	16	34,028,752 (GRCm38)	missense	probably benign
R8080:Kalrn	UTSW	16	33,975,668 (GRCm38)	missense	possibly damaging	0.83
R8147:Kalrn	UTSW	16	34,055,044 (GRCm38)	missense	probably benign
R8239:Kalrn	UTSW	16	34,049,783 (GRCm38)	missense	noncoding transcript
R8281:Kalrn	UTSW	16	34,035,061 (GRCm38)	nonsense	probably null
R8294:Kalrn	UTSW	16	34,033,584 (GRCm38)	missense	probably benign	0.12
R8301:Kalrn	UTSW	16	34,357,100 (GRCm38)	missense	probably benign	0.05
R8686:Kalrn	UTSW	16	34,360,935 (GRCm38)	missense	probably damaging	1.00
R8693:Kalrn	UTSW	16	34,034,514 (GRCm38)	missense	probably damaging	1.00
R8798:Kalrn	UTSW	16	33,982,855 (GRCm38)	missense	possibly damaging	0.65
R8878:Kalrn	UTSW	16	34,205,326 (GRCm38)	missense	probably damaging	1.00
R8878:Kalrn	UTSW	16	34,198,460 (GRCm38)	missense	probably benign	0.05
R8880:Kalrn	UTSW	16	34,217,935 (GRCm38)	missense	probably damaging	1.00
R8883:Kalrn	UTSW	16	33,993,655 (GRCm38)	missense	probably damaging	1.00
R8887:Kalrn	UTSW	16	34,227,126 (GRCm38)	missense	probably benign	0.22
R9048:Kalrn	UTSW	16	34,034,484 (GRCm38)	missense	possibly damaging	0.84
R9111:Kalrn	UTSW	16	34,361,001 (GRCm38)	missense	probably damaging	0.96
R9317:Kalrn	UTSW	16	34,013,675 (GRCm38)	missense
R9424:Kalrn	UTSW	16	33,988,818 (GRCm38)	missense	probably benign	0.06
R9442:Kalrn	UTSW	16	34,095,879 (GRCm38)	start codon destroyed	probably null	0.56
R9445:Kalrn	UTSW	16	33,985,230 (GRCm38)	missense	probably benign	0.13
R9515:Kalrn	UTSW	16	34,034,494 (GRCm38)	missense	probably damaging	1.00
R9516:Kalrn	UTSW	16	34,034,494 (GRCm38)	missense	probably damaging	1.00
R9625:Kalrn	UTSW	16	34,028,827 (GRCm38)	critical splice acceptor site	probably null
R9645:Kalrn	UTSW	16	34,212,213 (GRCm38)	missense	probably benign	0.01
RF014:Kalrn	UTSW	16	34,039,933 (GRCm38)	missense	probably benign	0.01
Z1177:Kalrn	UTSW	16	34,035,506 (GRCm38)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CTGTCTTTGGGTGAATGACAC -3'
(R):5'- TAGGAAACATGTAGCCCACGAG -3'

Sequencing Primer
(F):5'- TTATGCTGGAGACTGGCCC -3'
(R):5'- TGTAGCCCACGAGGACTGAATC -3'

Posted On

2015-09-25