Incidental Mutation 'R4620:Dll1'
ID345281
Institutional Source Beutler Lab
Gene Symbol Dll1
Ensembl Gene ENSMUSG00000014773
Gene Namedelta like canonical Notch ligand 1
SynonymsDelta1
MMRRC Submission 042008-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4620 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location15367354-15376872 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 15370566 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 332 (A332T)
Ref Sequence ENSEMBL: ENSMUSP00000014917 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014917] [ENSMUST00000143460]
Predicted Effect probably benign
Transcript: ENSMUST00000014917
AA Change: A332T

PolyPhen 2 Score 0.030 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000014917
Gene: ENSMUSG00000014773
AA Change: A332T

DomainStartEndE-ValueType
low complexity region 5 16 N/A INTRINSIC
Pfam:MNNL 21 93 2.2e-28 PFAM
DSL 158 220 3.91e-36 SMART
EGF 224 254 9.82e0 SMART
EGF 255 285 1.43e-1 SMART
EGF_CA 287 325 5.48e-12 SMART
EGF_CA 327 363 2.94e-12 SMART
EGF 368 402 3.54e-6 SMART
EGF_CA 404 440 8.5e-9 SMART
EGF_CA 442 478 2.08e-12 SMART
EGF 483 516 4.59e-5 SMART
transmembrane domain 545 567 N/A INTRINSIC
low complexity region 578 589 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124196
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129395
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140784
Predicted Effect probably benign
Transcript: ENSMUST00000143460
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152416
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181251
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 99% (80/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DLL1 is a human homolog of the Notch Delta ligand and is a member of the delta/serrate/jagged family. It plays a role in mediating cell fate decisions during hematopoiesis. It may play a role in cell-to-cell communication. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null embryos do not survive and have mesodermal segments with no cranio-caudal polarity and no epithelial somites develop; caudal sclerotome halves do not condense, the pattern. Mice heterozygous for a knock-out or ENU allele exhibit abnormal metabolic and immunological phenotypes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310057M21Rik A T 7: 131,343,606 Y433* probably null Het
Apba2 C T 7: 64,714,467 R331C probably damaging Het
Apod T C 16: 31,297,393 D173G probably benign Het
B3gnt5 A T 16: 19,769,882 M284L probably benign Het
Birc6 A C 17: 74,640,150 T2955P probably benign Het
Blvra T C 2: 127,096,965 I287T probably damaging Het
Capn5 T C 7: 98,129,371 Y347C probably damaging Het
Cdcp2 A G 4: 107,106,730 E259G probably damaging Het
Cdh2 A G 18: 16,648,608 V85A probably benign Het
Cdk5rap2 A G 4: 70,266,706 I1169T probably benign Het
Cenpj A G 14: 56,535,454 V1043A probably damaging Het
Cfap54 T A 10: 92,969,757 H1497L probably benign Het
Chat A G 14: 32,453,818 M95T probably damaging Het
Csmd1 T C 8: 16,002,694 probably null Het
Csmd3 T C 15: 47,585,753 E3615G probably benign Het
Cyp2c68 A T 19: 39,712,562 probably null Het
Dmrta1 A T 4: 89,688,784 Q159L probably benign Het
Eci3 A T 13: 34,948,758 M212K probably damaging Het
Eml4 T C 17: 83,461,533 F557L probably benign Het
Fat3 A T 9: 15,996,894 V2604D probably damaging Het
Frem3 T C 8: 80,668,957 V1871A possibly damaging Het
Gart T C 16: 91,625,433 N732S probably damaging Het
Gas2l2 T C 11: 83,423,098 I463V probably benign Het
H2-M3 C A 17: 37,272,419 T257K probably damaging Het
Hdgf A G 3: 87,914,576 N166S possibly damaging Het
Hoxb3 A T 11: 96,345,773 N226Y probably damaging Het
Itgav T C 2: 83,755,902 Y169H probably benign Het
Kalrn T G 16: 34,028,705 I426L probably damaging Het
Kcnh3 G A 15: 99,234,101 V646M probably damaging Het
Kif6 T C 17: 49,901,296 V735A probably benign Het
Krt2 T A 15: 101,817,591 I171F probably damaging Het
Megf8 G A 7: 25,355,098 A1880T possibly damaging Het
Miox A T 15: 89,336,121 Y172F probably benign Het
Myo18a G A 11: 77,817,947 R48H possibly damaging Het
Ndufb7 T C 8: 83,566,858 S14P probably damaging Het
Npepps A T 11: 97,238,244 H371Q probably damaging Het
Olfr596 C T 7: 103,309,958 T79I probably benign Het
Olfr672 T A 7: 104,996,623 I94F probably damaging Het
Olfr876 A G 9: 37,804,819 T303A probably benign Het
Olfr976 C T 9: 39,956,909 V9M probably damaging Het
Orc5 A T 5: 22,529,176 D203E probably damaging Het
Pappa A G 4: 65,327,028 T1518A probably benign Het
Pde6a A G 18: 61,262,492 D602G probably damaging Het
Pnliprp2 G A 19: 58,762,286 V136I possibly damaging Het
Postn A C 3: 54,376,993 D627A probably damaging Het
Prpf39 T C 12: 65,042,563 V25A probably benign Het
Pxdc1 A G 13: 34,652,314 I41T probably damaging Het
Rab11fip1 T A 8: 27,154,215 E514V probably damaging Het
Rag1 A T 2: 101,643,680 H372Q probably damaging Het
Ranbp1 A G 16: 18,240,104 probably benign Het
Rexo5 A G 7: 119,827,303 I317V probably benign Het
Rragc A G 4: 123,924,829 Q279R probably damaging Het
Sbf1 A G 15: 89,306,926 S187P probably damaging Het
Senp3 T A 11: 69,677,118 Y432F probably benign Het
Slfn5 G A 11: 82,961,652 C868Y probably damaging Het
Sorcs2 C T 5: 36,037,494 A722T probably benign Het
Sptb A T 12: 76,583,807 C2244* probably null Het
Srbd1 A T 17: 86,109,265 F488L probably benign Het
Sucnr1 A G 3: 60,086,769 I239M possibly damaging Het
Themis2 A G 4: 132,786,022 W298R probably damaging Het
Tmem168 T G 6: 13,594,953 N37T probably benign Het
Tmem62 A G 2: 120,996,364 probably benign Het
Tmprss15 T C 16: 79,021,470 D524G probably damaging Het
Trav5-4 G T 14: 53,704,396 M75I probably benign Het
Trio T A 15: 27,871,171 H620L probably damaging Het
Ubap2 C T 4: 41,233,698 G64E probably damaging Het
Usp32 C A 11: 85,059,127 probably null Het
Wdfy3 A T 5: 101,906,145 F1603Y probably damaging Het
Wdr63 A T 3: 146,042,809 L850Q probably damaging Het
Xpo4 A T 14: 57,630,325 L155Q probably damaging Het
Zbtb21 T C 16: 97,949,892 T1092A possibly damaging Het
Zfp780b A T 7: 27,962,753 Y792* probably null Het
Other mutations in Dll1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01432:Dll1 APN 17 15368506 missense probably damaging 0.98
IGL03006:Dll1 APN 17 15373592 missense probably benign 0.00
IGL03218:Dll1 APN 17 15373568 missense probably benign 0.14
IGL03281:Dll1 APN 17 15373604 missense probably benign 0.03
R0054:Dll1 UTSW 17 15368954 missense probably damaging 1.00
R1345:Dll1 UTSW 17 15373555 nonsense probably null
R2290:Dll1 UTSW 17 15374748 missense probably benign 0.00
R3776:Dll1 UTSW 17 15368524 missense probably benign
R4837:Dll1 UTSW 17 15368859 missense probably damaging 1.00
R4874:Dll1 UTSW 17 15370239 missense probably benign 0.08
R5252:Dll1 UTSW 17 15368689 missense probably damaging 1.00
R6726:Dll1 UTSW 17 15370251 missense probably damaging 1.00
R7180:Dll1 UTSW 17 15374869 missense probably benign 0.03
R7453:Dll1 UTSW 17 15374889 missense probably benign 0.18
R7542:Dll1 UTSW 17 15370347 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGTGCAAGAGAAGCTGTCC -3'
(R):5'- ATTGCCAGGTCTCCTCAAAGC -3'

Sequencing Primer
(F):5'- AGAGAAGCTGTCCTCAAGGTCC -3'
(R):5'- ACTGGAAACATAGATCCTTCCTG -3'
Posted On2015-09-25