Incidental Mutation 'R3982:Itga8'
ID 345292
Institutional Source Beutler Lab
Gene Symbol Itga8
Ensembl Gene ENSMUSG00000026768
Gene Name integrin alpha 8
Synonyms
MMRRC Submission 041608-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.892) question?
Stock # R3982 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 12106632-12301922 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 12300963 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 72 (V72A)
Ref Sequence ENSEMBL: ENSMUSP00000028106 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028106] [ENSMUST00000172791]
AlphaFold A2ARA8
Predicted Effect possibly damaging
Transcript: ENSMUST00000028106
AA Change: V72A

PolyPhen 2 Score 0.923 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000028106
Gene: ENSMUSG00000026768
AA Change: V72A

DomainStartEndE-ValueType
signal peptide 1 37 N/A INTRINSIC
Int_alpha 52 112 8.48e-8 SMART
Int_alpha 197 244 4.8e1 SMART
Int_alpha 262 312 5.91e-7 SMART
Int_alpha 316 377 6.94e-13 SMART
Int_alpha 381 437 1.92e-15 SMART
Int_alpha 445 494 8.23e-6 SMART
SCOP:d1m1xa2 643 780 2e-46 SMART
SCOP:d1m1xa3 784 1000 2e-80 SMART
transmembrane domain 1011 1033 N/A INTRINSIC
Pfam:Integrin_alpha 1034 1048 2.5e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130548
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141477
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148089
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150037
Predicted Effect possibly damaging
Transcript: ENSMUST00000172791
AA Change: V72A

PolyPhen 2 Score 0.812 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000134154
Gene: ENSMUSG00000026768
AA Change: V72A

DomainStartEndE-ValueType
signal peptide 1 37 N/A INTRINSIC
Int_alpha 52 112 8.48e-8 SMART
Int_alpha 197 244 4.8e1 SMART
Int_alpha 262 312 5.91e-7 SMART
Int_alpha 316 377 6.94e-13 SMART
Int_alpha 381 437 1.92e-15 SMART
Int_alpha 445 494 8.23e-6 SMART
Meta Mutation Damage Score 0.2525 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 98% (40/41)
MGI Phenotype FUNCTION: This gene encodes a member of the integrin family of cell surface proteins that mediate cellular interactions with the extracellular matrix and other cells. The encoded protein undergoes proteolytic processing to generate the disulfide-linked heterodimeric alpha subunit which, in turn associates with a beta subunit to form the functional integrin receptor. Mice lacking the encoded protein mostly die after birth due to kidney defects, but some of animals that survive exhibit defects in the sensory hair cells of the inner ear. [provided by RefSeq, Aug 2016]
PHENOTYPE: Mice homozygous for disruptions in this gene usually die by the end of the second day after birth. Those that do survive have reduced kidneys and abnormal steriocilia in the inner ear. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921504E06Rik A G 2: 19,542,369 probably null Het
Adgrg6 T C 10: 14,448,845 N445S probably benign Het
Adgrl3 A G 5: 81,694,526 T902A possibly damaging Het
Atf4 T C 15: 80,256,868 V153A probably benign Het
BC005561 T C 5: 104,521,023 V1137A probably benign Het
Bsn T C 9: 108,107,166 T3230A unknown Het
Cadps2 A G 6: 23,263,531 probably benign Het
Clca3a1 T A 3: 144,755,309 T194S probably benign Het
Cth A T 3: 157,913,697 L163* probably null Het
Flnc G A 6: 29,442,941 V492M probably damaging Het
Frmd6 T C 12: 70,887,834 L269P probably damaging Het
Gpr62 G A 9: 106,464,886 A281V probably benign Het
Hapln1 T A 13: 89,605,441 F242Y probably benign Het
Ighv1-39 A T 12: 114,914,631 S107T possibly damaging Het
Kcp A T 6: 29,484,637 L1314Q probably damaging Het
Klre1 T A 6: 129,583,138 C124* probably null Het
Lrrk2 T A 15: 91,709,284 M482K probably benign Het
Man2b2 T C 5: 36,813,820 N734S probably benign Het
Map3k20 C T 2: 72,438,227 T526I probably damaging Het
Mdga1 C A 17: 29,931,264 A125S unknown Het
Mmd2 T C 5: 142,564,799 Y228C probably damaging Het
Mme T A 3: 63,328,064 Y178N probably damaging Het
Nifk T A 1: 118,329,552 S138R possibly damaging Het
Nlrp4b T C 7: 10,714,431 V187A possibly damaging Het
Palmd T C 3: 116,923,823 T342A probably benign Het
Pigo A T 4: 43,023,482 S231T probably benign Het
Pik3cb G A 9: 99,046,601 T867M probably benign Het
Plag1 A T 4: 3,904,055 S379T probably damaging Het
Polg2 G A 11: 106,779,202 R81* probably null Het
Prpf4b C T 13: 34,884,213 probably benign Het
Ptprq T A 10: 107,543,396 I1981F probably damaging Het
Usp24 G A 4: 106,387,883 E1307K probably benign Het
Vmn2r115 T A 17: 23,359,974 M807K probably damaging Het
Wee2 A T 6: 40,455,241 N248I possibly damaging Het
Other mutations in Itga8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00806:Itga8 APN 2 12255966 nonsense probably null
IGL00820:Itga8 APN 2 12232892 missense possibly damaging 0.85
IGL01409:Itga8 APN 2 12191714 missense probably benign
IGL01508:Itga8 APN 2 12232802 missense possibly damaging 0.67
IGL01585:Itga8 APN 2 12160312 splice site probably benign
IGL01590:Itga8 APN 2 12160333 missense probably damaging 1.00
IGL01743:Itga8 APN 2 12265333 missense probably benign 0.04
IGL02634:Itga8 APN 2 12140478 missense possibly damaging 0.55
IGL02805:Itga8 APN 2 12189480 missense possibly damaging 0.83
IGL03200:Itga8 APN 2 12191199 missense probably benign 0.00
IGL03218:Itga8 APN 2 12111025 missense possibly damaging 0.77
IGL03248:Itga8 APN 2 12132516 missense probably benign 0.20
PIT4576001:Itga8 UTSW 2 12230092 missense probably benign 0.19
R0196:Itga8 UTSW 2 12204729 critical splice donor site probably null
R0356:Itga8 UTSW 2 12182721 missense possibly damaging 0.73
R0466:Itga8 UTSW 2 12232886 missense probably damaging 1.00
R0530:Itga8 UTSW 2 12191816 missense probably damaging 0.99
R0715:Itga8 UTSW 2 12191242 splice site probably benign
R0800:Itga8 UTSW 2 12193551 missense possibly damaging 0.95
R0881:Itga8 UTSW 2 12262192 splice site probably null
R1675:Itga8 UTSW 2 12200163 missense probably damaging 0.99
R1758:Itga8 UTSW 2 12265333 missense possibly damaging 0.83
R1939:Itga8 UTSW 2 12300846 missense probably damaging 1.00
R2187:Itga8 UTSW 2 12194420 missense possibly damaging 0.60
R2295:Itga8 UTSW 2 12182709 missense probably benign 0.38
R2356:Itga8 UTSW 2 12200141 missense probably benign
R2371:Itga8 UTSW 2 12253466 missense probably damaging 1.00
R2412:Itga8 UTSW 2 12301715 missense probably benign
R2440:Itga8 UTSW 2 12178680 missense possibly damaging 0.70
R2848:Itga8 UTSW 2 12160404 missense probably damaging 0.98
R3730:Itga8 UTSW 2 12193510 missense possibly damaging 0.92
R3933:Itga8 UTSW 2 12189519 missense probably benign
R4513:Itga8 UTSW 2 12182736 missense probably benign 0.01
R4514:Itga8 UTSW 2 12182736 missense probably benign 0.01
R4660:Itga8 UTSW 2 12265258 missense probably damaging 1.00
R4890:Itga8 UTSW 2 12193291 splice site probably benign
R5533:Itga8 UTSW 2 12160350 missense possibly damaging 0.90
R5619:Itga8 UTSW 2 12265328 missense probably damaging 1.00
R5720:Itga8 UTSW 2 12111087 missense probably damaging 0.99
R5749:Itga8 UTSW 2 12262078 missense probably damaging 1.00
R5930:Itga8 UTSW 2 12230208 missense possibly damaging 0.84
R5954:Itga8 UTSW 2 12132486 missense probably damaging 0.99
R6035:Itga8 UTSW 2 12191714 missense probably benign
R6035:Itga8 UTSW 2 12191714 missense probably benign
R6211:Itga8 UTSW 2 12193509 missense probably damaging 1.00
R6337:Itga8 UTSW 2 12253469 nonsense probably null
R6442:Itga8 UTSW 2 12230143 missense probably benign 0.00
R6491:Itga8 UTSW 2 12204776 missense probably damaging 1.00
R6543:Itga8 UTSW 2 12301644 missense probably damaging 0.99
R6574:Itga8 UTSW 2 12230161 missense probably benign 0.17
R6760:Itga8 UTSW 2 12301640 missense probably damaging 1.00
R6858:Itga8 UTSW 2 12200081 missense probably benign 0.00
R6943:Itga8 UTSW 2 12155371 critical splice donor site probably null
R7048:Itga8 UTSW 2 12111084 missense probably damaging 0.99
R7203:Itga8 UTSW 2 12230095 missense possibly damaging 0.77
R7266:Itga8 UTSW 2 12232901 missense probably damaging 1.00
R7323:Itga8 UTSW 2 12262129 missense probably damaging 1.00
R7540:Itga8 UTSW 2 12111037 missense possibly damaging 0.82
R7637:Itga8 UTSW 2 12109187 missense probably damaging 1.00
R7748:Itga8 UTSW 2 12230239 missense possibly damaging 0.80
R7848:Itga8 UTSW 2 12191737 missense probably damaging 0.99
R8031:Itga8 UTSW 2 12155486 missense probably benign
R8077:Itga8 UTSW 2 12242433 missense probably benign 0.09
R8757:Itga8 UTSW 2 12262129 missense probably damaging 1.00
R8759:Itga8 UTSW 2 12262129 missense probably damaging 1.00
R8772:Itga8 UTSW 2 12182684 missense probably damaging 1.00
R8773:Itga8 UTSW 2 12182684 missense probably damaging 1.00
R8774:Itga8 UTSW 2 12182684 missense probably damaging 1.00
R8774-TAIL:Itga8 UTSW 2 12182684 missense probably damaging 1.00
R8775:Itga8 UTSW 2 12182684 missense probably damaging 1.00
R8775-TAIL:Itga8 UTSW 2 12182684 missense probably damaging 1.00
R8808:Itga8 UTSW 2 12132517 nonsense probably null
R8898:Itga8 UTSW 2 12140395 missense probably benign 0.05
R8962:Itga8 UTSW 2 12191234 missense possibly damaging 0.94
R9056:Itga8 UTSW 2 12230208 missense possibly damaging 0.84
R9155:Itga8 UTSW 2 12189519 missense probably benign
R9354:Itga8 UTSW 2 12232857 missense possibly damaging 0.94
R9563:Itga8 UTSW 2 12160408 missense possibly damaging 0.83
R9589:Itga8 UTSW 2 12232890 missense probably damaging 1.00
R9663:Itga8 UTSW 2 12191769 missense probably benign 0.00
Z1176:Itga8 UTSW 2 12247518 missense probably damaging 1.00
Z1176:Itga8 UTSW 2 12262136 missense probably benign 0.01
Z1176:Itga8 UTSW 2 12301832 start gained probably benign
Z1177:Itga8 UTSW 2 12300933 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- AGAACACTAAATTGCCGCGAG -3'
(R):5'- AACCATTAGCAGCCTCTTCC -3'

Sequencing Primer
(F):5'- AGGAATGGCTCTGGTTCTTTTCAAC -3'
(R):5'- AGCCTCTTCCAAAACCAGGTTTC -3'
Posted On 2015-09-25