Mutagenetix > Incidental Mutation

Incidental Mutation 'R4598:A830018L16Rik'

345326

Institutional Source

Beutler Lab

Gene Symbol

A830018L16Rik

Ensembl Gene

ENSMUSG00000057715

Gene Name

RIKEN cDNA A830018L16 gene

Synonyms

MMRRC Submission

041814-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.060) question?

Stock #

R4598 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

11414105-11975901 bp(+) (GRCm38)

Type of Mutation

critical splice acceptor site

DNA Base Change (assembly)

G to A at 11747964 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000137287 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000048613] [ENSMUST00000048613] [ENSMUST00000137824] [ENSMUST00000137824] [ENSMUST00000141512] [ENSMUST00000141512] [ENSMUST00000179089] [ENSMUST00000179089]

AlphaFold

no structure available at present

Predicted Effect

probably null
Transcript: ENSMUST00000048613

SMART Domains

Protein: ENSMUSP00000043857
Gene: ENSMUSG00000057715

Domain	Start	End	E-Value	Type
low complexity region	58	73	N/A	INTRINSIC
low complexity region	213	223	N/A	INTRINSIC
low complexity region	233	248	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000048613

SMART Domains

Protein: ENSMUSP00000043857
Gene: ENSMUSG00000057715

Domain	Start	End	E-Value	Type
low complexity region	58	73	N/A	INTRINSIC
low complexity region	213	223	N/A	INTRINSIC
low complexity region	233	248	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000137824

SMART Domains

Protein: ENSMUSP00000117421
Gene: ENSMUSG00000057715

Domain	Start	End	E-Value	Type
low complexity region	58	73	N/A	INTRINSIC
low complexity region	213	223	N/A	INTRINSIC
low complexity region	233	248	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000137824

SMART Domains

Protein: ENSMUSP00000117421
Gene: ENSMUSG00000057715

Domain	Start	End	E-Value	Type
low complexity region	58	73	N/A	INTRINSIC
low complexity region	213	223	N/A	INTRINSIC
low complexity region	233	248	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000141512

SMART Domains

Protein: ENSMUSP00000139635
Gene: ENSMUSG00000057715

Domain	Start	End	E-Value	Type
low complexity region	58	73	N/A	INTRINSIC
low complexity region	213	223	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000141512

SMART Domains

Protein: ENSMUSP00000139635
Gene: ENSMUSG00000057715

Domain	Start	End	E-Value	Type
low complexity region	58	73	N/A	INTRINSIC
low complexity region	213	223	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000179089

Predicted Effect

probably null
Transcript: ENSMUST00000179089

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 95.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is related to the cyclic AMP dependent protein kinase regulators. Naturally occurring mutations in this gene are associated with an increased risk for severe toxicities, such as diarrhea and neutropenia, in patients undergoing chemotherapeutic treatment. [provided by RefSeq, Mar 2017]

Allele List at MGI

Other mutations in this stock

Total: 67 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca14	T	C	7: 120,255,403	V930A	probably benign	Het
Abcb7	A	C	X: 104,323,382	D135E	probably benign	Het
Ace	T	A	11: 105,981,759		probably null	Het
Acnat1	T	C	4: 49,450,781	D110G	probably benign	Het
Ak9	C	T	10: 41,383,911	P862S	probably damaging	Het
Atp1a3	A	G	7: 24,979,341	S972P	probably damaging	Het
Bmf	C	A	2: 118,549,128	A56S	probably benign	Het
C6	T	C	15: 4,763,370	L319P	possibly damaging	Het
Cab39	A	G	1: 85,848,329	Y249C	probably damaging	Het
Cdc14b	T	C	13: 64,247,274	T69A	probably benign	Het
Cep162	A	G	9: 87,203,795	Y1159H	possibly damaging	Het
Chrna7	A	G	7: 63,103,790	M327T	probably damaging	Het
Clca3a2	A	T	3: 144,805,683	N41K	probably damaging	Het
Clock	T	C	5: 76,235,810	M499V	probably benign	Het
Col5a3	A	G	9: 20,774,559		probably null	Het
Coq6	T	C	12: 84,362,139	V30A	probably benign	Het
Cyp3a57	A	G	5: 145,390,417	I473V	probably benign	Het
D430041D05Rik	A	T	2: 104,208,183	V1547D	probably damaging	Het
Dhx9	TCC	TC	1: 153,467,051		probably null	Het
Dock2	T	A	11: 34,239,536	Y1545F	probably damaging	Het
Eif4e3	T	A	6: 99,640,710	I67L	probably benign	Het
Epor	A	G	9: 21,961,859	S86P	probably benign	Het
Esp31	T	A	17: 38,641,121		probably null	Het
Esrp2	A	G	8: 106,132,711	M498T	probably damaging	Het
F5	T	C	1: 164,204,797	I1771T	probably benign	Het
Fancd2	C	A	6: 113,585,477	H1259Q	probably benign	Het
Gale	C	A	4: 135,967,837	S341*	probably null	Het
Ints12	T	A	3: 133,098,453	I67N	probably benign	Het
Kat2b	A	G	17: 53,670,798	Y791C	probably benign	Het
Kazn	A	G	4: 142,210,092	V108A	possibly damaging	Het
Kcnma1	T	C	14: 23,803,160	T109A	probably damaging	Het
Med13	T	C	11: 86,278,566	T1955A	probably damaging	Het
Megf10	G	A	18: 57,189,603		probably null	Het
Megf10	A	T	18: 57,287,812	S841C	probably damaging	Het
Mep1a	A	G	17: 43,491,578		probably null	Het
Mrap2	A	T	9: 87,182,789	E194D	probably damaging	Het
Msh2	A	G	17: 87,708,578	K546R	probably damaging	Het
Ndc80	T	C	17: 71,521,068	D88G	probably damaging	Het
Nrip1	A	G	16: 76,293,080	F530L	probably damaging	Het
Olfr1380	T	C	11: 49,564,718	S266P	probably damaging	Het
Olfr1504	A	T	19: 13,888,017	H64Q	probably damaging	Het
Olfr676	A	C	7: 105,036,073	I292L	probably benign	Het
Olfr812	T	C	10: 129,842,995	T16A	possibly damaging	Het
Oxtr	C	T	6: 112,489,752	G16R	probably benign	Het
Pdgfrb	A	T	18: 61,068,757	K464N	probably benign	Het
Pja2	A	T	17: 64,313,030	M1K	probably null	Het
Pkhd1	A	T	1: 20,503,056	N1875K	probably damaging	Het
Pogz	T	C	3: 94,880,180	S1360P	possibly damaging	Het
Proc	A	T	18: 32,123,459	L385Q	probably damaging	Het
Ptprm	A	G	17: 67,095,497	I132T	probably benign	Het
Rpgr	A	G	X: 10,196,016	S343P	probably benign	Het
Rsu1	T	C	2: 13,170,004	Y225C	probably damaging	Het
Scyl1	A	G	19: 5,770,453	S118P	probably damaging	Het
Sec61a1	T	C	6: 88,506,149	N414D	probably benign	Het
Secisbp2l	C	T	2: 125,740,737	G933D	possibly damaging	Het
Sema7a	A	G	9: 57,953,551	D65G	probably benign	Het
Slc25a45	A	G	19: 5,884,436	Y144C	probably damaging	Het
Slc26a6	A	G	9: 108,856,380	Y103C	probably damaging	Het
Stat3	C	T	11: 100,903,674	D270N	probably damaging	Het
Taar8b	T	C	10: 24,091,838	S153G	probably benign	Het
Top1	A	G	2: 160,720,965	E697G	possibly damaging	Het
Trappc11	G	A	8: 47,513,766	T470I	probably damaging	Het
Ttc7b	G	A	12: 100,500,117	R79C	probably damaging	Het
Usp29	A	G	7: 6,962,480	T441A	probably benign	Het
Vmn2r110	A	T	17: 20,583,767	L182*	probably null	Het
Zgrf1	T	C	3: 127,601,030	I1345T	probably benign	Het
Zscan25	G	T	5: 145,291,005	R493L	probably benign	Het

Other mutations in A830018L16Rik

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00426:A830018L16Rik	APN	1	11748054	missense	probably damaging	0.98
IGL01916:A830018L16Rik	APN	1	11748107	splice site	probably benign
IGL02040:A830018L16Rik	APN	1	11933598	intron	probably benign
IGL02432:A830018L16Rik	APN	1	11748079	missense	probably damaging	1.00
IGL02693:A830018L16Rik	APN	1	11596282	missense	probably damaging	1.00
IGL02736:A830018L16Rik	APN	1	11972051	missense	probably benign	0.02
IGL03293:A830018L16Rik	APN	1	11545151	splice site	probably null
IGL02835:A830018L16Rik	UTSW	1	11972055	missense	possibly damaging	0.54
R1203:A830018L16Rik	UTSW	1	11518594	missense	probably damaging	1.00
R1216:A830018L16Rik	UTSW	1	11798492	missense	probably damaging	0.99
R1548:A830018L16Rik	UTSW	1	11518594	missense	probably damaging	1.00
R1644:A830018L16Rik	UTSW	1	11414590	nonsense	probably null
R1855:A830018L16Rik	UTSW	1	11747971	missense	probably damaging	1.00
R1858:A830018L16Rik	UTSW	1	11974953	missense	unknown
R2265:A830018L16Rik	UTSW	1	11972104	critical splice donor site	probably null
R2296:A830018L16Rik	UTSW	1	11512051	missense	possibly damaging	0.94
R2484:A830018L16Rik	UTSW	1	11596302	missense	probably damaging	1.00
R3730:A830018L16Rik	UTSW	1	11545226	missense	probably damaging	1.00
R3752:A830018L16Rik	UTSW	1	11518680	missense	probably damaging	1.00
R3861:A830018L16Rik	UTSW	1	11588554	splice site	probably benign
R4305:A830018L16Rik	UTSW	1	11972076	nonsense	probably null
R4306:A830018L16Rik	UTSW	1	11972076	nonsense	probably null
R4307:A830018L16Rik	UTSW	1	11972076	nonsense	probably null
R4558:A830018L16Rik	UTSW	1	11972076	nonsense	probably null
R4652:A830018L16Rik	UTSW	1	11537342	intron	probably benign
R5492:A830018L16Rik	UTSW	1	11545207	missense	probably damaging	0.99
R5493:A830018L16Rik	UTSW	1	11545207	missense	probably damaging	0.99
R5802:A830018L16Rik	UTSW	1	11950964	missense	probably damaging	1.00
R6007:A830018L16Rik	UTSW	1	11511916	critical splice acceptor site	probably null
R6082:A830018L16Rik	UTSW	1	11798528	missense	probably benign	0.04
R6376:A830018L16Rik	UTSW	1	11798494	missense	probably damaging	0.98
R6453:A830018L16Rik	UTSW	1	11798558	missense	possibly damaging	0.91
R6757:A830018L16Rik	UTSW	1	11596334	makesense	probably null
R6833:A830018L16Rik	UTSW	1	11588509	missense	probably damaging	1.00
R7163:A830018L16Rik	UTSW	1	11414624	missense	probably damaging	0.96
R7272:A830018L16Rik	UTSW	1	11588471	missense	probably damaging	0.97
R7566:A830018L16Rik	UTSW	1	11951028	missense	probably damaging	1.00
R7665:A830018L16Rik	UTSW	1	11972099	missense	probably damaging	0.96
R8004:A830018L16Rik	UTSW	1	11951062	splice site	probably benign
R8754:A830018L16Rik	UTSW	1	11545248	missense	probably benign	0.33
R8944:A830018L16Rik	UTSW	1	11414482	unclassified	probably benign
R8993:A830018L16Rik	UTSW	1	11545267	nonsense	probably null
R8997:A830018L16Rik	UTSW	1	11545267	nonsense	probably null
R9098:A830018L16Rik	UTSW	1	11562987	missense	probably damaging	1.00
R9640:A830018L16Rik	UTSW	1	11950976	missense	probably damaging	0.98
R9704:A830018L16Rik	UTSW	1	11518689	missense	probably damaging	1.00
R9705:A830018L16Rik	UTSW	1	11518689	missense	probably damaging	1.00
Z1176:A830018L16Rik	UTSW	1	11518625	missense	probably damaging	0.96

Predicted Primers

PCR Primer
(F):5'- TGGACAAGCCCCTCAAACTG -3'
(R):5'- ACCCTCTTTGCATCAAAATCTTAGC -3'

Sequencing Primer
(F):5'- CCCTCAAACTGTAGGTGGATGAGTC -3'
(R):5'- TGCATCAAAATCTTAGCTATACACAC -3'

Posted On

2015-09-25