Incidental Mutation 'R4598:Ints12'
ID 345339
Institutional Source Beutler Lab
Gene Symbol Ints12
Ensembl Gene ENSMUSG00000028016
Gene Name integrator complex subunit 12
Synonyms Phf22, 2810027J24Rik, 1110020M19Rik, 4930529N21Rik, A230056J18Rik
MMRRC Submission 041814-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R4598 (G1)
Quality Score 225
Status Not validated
Chromosome 3
Chromosomal Location 133091840-133110988 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 133098453 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 67 (I67N)
Ref Sequence ENSEMBL: ENSMUSP00000029650 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029650]
AlphaFold Q9D168
PDB Structure Solution structure of PHD domain in protein NP_082203 [SOLUTION NMR]
Predicted Effect probably benign
Transcript: ENSMUST00000029650
AA Change: I67N

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000029650
Gene: ENSMUSG00000028016
AA Change: I67N

DomainStartEndE-ValueType
internal_repeat_1 23 67 4.54e-5 PROSPERO
low complexity region 74 82 N/A INTRINSIC
internal_repeat_1 91 139 4.54e-5 PROSPERO
PHD 160 212 4.63e-9 SMART
low complexity region 219 240 N/A INTRINSIC
low complexity region 269 291 N/A INTRINSIC
low complexity region 337 373 N/A INTRINSIC
low complexity region 381 436 N/A INTRINSIC
low complexity region 451 461 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160036
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160669
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] INTS12 is a subunit of the Integrator complex, which associates with the C-terminal domain of RNA polymerase II large subunit (POLR2A; MIM 180660) and mediates 3-prime end processing of small nuclear RNAs U1 (RNU1; MIM 180680) and U2 (RNU2; MIM 180690) (Baillat et al., 2005 [PubMed 16239144]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830018L16Rik G A 1: 11,747,964 probably null Het
Abca14 T C 7: 120,255,403 V930A probably benign Het
Abcb7 A C X: 104,323,382 D135E probably benign Het
Ace T A 11: 105,981,759 probably null Het
Acnat1 T C 4: 49,450,781 D110G probably benign Het
Ak9 C T 10: 41,383,911 P862S probably damaging Het
Atp1a3 A G 7: 24,979,341 S972P probably damaging Het
Bmf C A 2: 118,549,128 A56S probably benign Het
C6 T C 15: 4,763,370 L319P possibly damaging Het
Cab39 A G 1: 85,848,329 Y249C probably damaging Het
Cdc14b T C 13: 64,247,274 T69A probably benign Het
Cep162 A G 9: 87,203,795 Y1159H possibly damaging Het
Chrna7 A G 7: 63,103,790 M327T probably damaging Het
Clca3a2 A T 3: 144,805,683 N41K probably damaging Het
Clock T C 5: 76,235,810 M499V probably benign Het
Col5a3 A G 9: 20,774,559 probably null Het
Coq6 T C 12: 84,362,139 V30A probably benign Het
Cyp3a57 A G 5: 145,390,417 I473V probably benign Het
D430041D05Rik A T 2: 104,208,183 V1547D probably damaging Het
Dhx9 TCC TC 1: 153,467,051 probably null Het
Dock2 T A 11: 34,239,536 Y1545F probably damaging Het
Eif4e3 T A 6: 99,640,710 I67L probably benign Het
Epor A G 9: 21,961,859 S86P probably benign Het
Esp31 T A 17: 38,641,121 probably null Het
Esrp2 A G 8: 106,132,711 M498T probably damaging Het
F5 T C 1: 164,204,797 I1771T probably benign Het
Fancd2 C A 6: 113,585,477 H1259Q probably benign Het
Gale C A 4: 135,967,837 S341* probably null Het
Kat2b A G 17: 53,670,798 Y791C probably benign Het
Kazn A G 4: 142,210,092 V108A possibly damaging Het
Kcnma1 T C 14: 23,803,160 T109A probably damaging Het
Med13 T C 11: 86,278,566 T1955A probably damaging Het
Megf10 G A 18: 57,189,603 probably null Het
Megf10 A T 18: 57,287,812 S841C probably damaging Het
Mep1a A G 17: 43,491,578 probably null Het
Mrap2 A T 9: 87,182,789 E194D probably damaging Het
Msh2 A G 17: 87,708,578 K546R probably damaging Het
Ndc80 T C 17: 71,521,068 D88G probably damaging Het
Nrip1 A G 16: 76,293,080 F530L probably damaging Het
Olfr1380 T C 11: 49,564,718 S266P probably damaging Het
Olfr1504 A T 19: 13,888,017 H64Q probably damaging Het
Olfr676 A C 7: 105,036,073 I292L probably benign Het
Olfr812 T C 10: 129,842,995 T16A possibly damaging Het
Oxtr C T 6: 112,489,752 G16R probably benign Het
Pdgfrb A T 18: 61,068,757 K464N probably benign Het
Pja2 A T 17: 64,313,030 M1K probably null Het
Pkhd1 A T 1: 20,503,056 N1875K probably damaging Het
Pogz T C 3: 94,880,180 S1360P possibly damaging Het
Proc A T 18: 32,123,459 L385Q probably damaging Het
Ptprm A G 17: 67,095,497 I132T probably benign Het
Rpgr A G X: 10,196,016 S343P probably benign Het
Rsu1 T C 2: 13,170,004 Y225C probably damaging Het
Scyl1 A G 19: 5,770,453 S118P probably damaging Het
Sec61a1 T C 6: 88,506,149 N414D probably benign Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Sema7a A G 9: 57,953,551 D65G probably benign Het
Slc25a45 A G 19: 5,884,436 Y144C probably damaging Het
Slc26a6 A G 9: 108,856,380 Y103C probably damaging Het
Stat3 C T 11: 100,903,674 D270N probably damaging Het
Taar8b T C 10: 24,091,838 S153G probably benign Het
Top1 A G 2: 160,720,965 E697G possibly damaging Het
Trappc11 G A 8: 47,513,766 T470I probably damaging Het
Ttc7b G A 12: 100,500,117 R79C probably damaging Het
Usp29 A G 7: 6,962,480 T441A probably benign Het
Vmn2r110 A T 17: 20,583,767 L182* probably null Het
Zgrf1 T C 3: 127,601,030 I1345T probably benign Het
Zscan25 G T 5: 145,291,005 R493L probably benign Het
Other mutations in Ints12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00585:Ints12 APN 3 133100809 critical splice donor site probably null
R0243:Ints12 UTSW 3 133109045 missense probably benign 0.37
R0847:Ints12 UTSW 3 133108842 missense possibly damaging 0.72
R2118:Ints12 UTSW 3 133109160 missense probably damaging 0.98
R2323:Ints12 UTSW 3 133109365 missense possibly damaging 0.60
R2324:Ints12 UTSW 3 133109365 missense possibly damaging 0.60
R2384:Ints12 UTSW 3 133109103 splice site probably null
R3055:Ints12 UTSW 3 133109365 missense possibly damaging 0.60
R3056:Ints12 UTSW 3 133109365 missense possibly damaging 0.60
R3919:Ints12 UTSW 3 133100683 missense probably benign
R4431:Ints12 UTSW 3 133102481 missense probably damaging 1.00
R4594:Ints12 UTSW 3 133108868 missense probably benign 0.00
R4599:Ints12 UTSW 3 133098453 missense probably benign
R4702:Ints12 UTSW 3 133096785 missense probably damaging 1.00
R5083:Ints12 UTSW 3 133100777 missense possibly damaging 0.54
R5507:Ints12 UTSW 3 133109160 missense probably damaging 1.00
R5894:Ints12 UTSW 3 133098558 missense probably damaging 1.00
R6647:Ints12 UTSW 3 133096878 missense possibly damaging 0.88
R8245:Ints12 UTSW 3 133108872 missense probably benign
R8887:Ints12 UTSW 3 133109242 missense probably damaging 0.99
R9779:Ints12 UTSW 3 133106991 missense probably benign 0.30
Z1176:Ints12 UTSW 3 133102464 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTGGAGACTGTTTAGGTCATTAC -3'
(R):5'- TGATGTAACTCCGCCCACTG -3'

Sequencing Primer
(F):5'- ACTGTTTAGGTCATTACTTTCTGTGC -3'
(R):5'- TCCGCCCACTGCTACATAAAG -3'
Posted On 2015-09-25