Incidental Mutation 'R4598:Clca3a2'
ID345340
Institutional Source Beutler Lab
Gene Symbol Clca3a2
Ensembl Gene ENSMUSG00000028262
Gene Namechloride channel accessory 3A2
SynonymsClca2
MMRRC Submission 041814-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.206) question?
Stock #R4598 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location144796559-144819494 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 144805683 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 41 (N41K)
Ref Sequence ENSEMBL: ENSMUSP00000143543 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029929] [ENSMUST00000199029]
Predicted Effect probably damaging
Transcript: ENSMUST00000029929
AA Change: N650K

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000029929
Gene: ENSMUSG00000028262
AA Change: N650K

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
VWA 306 478 1.5e-21 SMART
FN3 758 857 5.49e0 SMART
Predicted Effect unknown
Transcript: ENSMUST00000197013
AA Change: N210K
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198543
Predicted Effect probably damaging
Transcript: ENSMUST00000199029
AA Change: N41K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000143543
Gene: ENSMUSG00000028262
AA Change: N41K

DomainStartEndE-ValueType
Pfam:CLCA 1 188 6.5e-77 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830018L16Rik G A 1: 11,747,964 probably null Het
Abca14 T C 7: 120,255,403 V930A probably benign Het
Abcb7 A C X: 104,323,382 D135E probably benign Het
Ace T A 11: 105,981,759 probably null Het
Acnat1 T C 4: 49,450,781 D110G probably benign Het
Ak9 C T 10: 41,383,911 P862S probably damaging Het
Atp1a3 A G 7: 24,979,341 S972P probably damaging Het
Bmf C A 2: 118,549,128 A56S probably benign Het
C6 T C 15: 4,763,370 L319P possibly damaging Het
Cab39 A G 1: 85,848,329 Y249C probably damaging Het
Cdc14b T C 13: 64,247,274 T69A probably benign Het
Cep162 A G 9: 87,203,795 Y1159H possibly damaging Het
Chrna7 A G 7: 63,103,790 M327T probably damaging Het
Clock T C 5: 76,235,810 M499V probably benign Het
Col5a3 A G 9: 20,774,559 probably null Het
Coq6 T C 12: 84,362,139 V30A probably benign Het
Cyp3a57 A G 5: 145,390,417 I473V probably benign Het
D430041D05Rik A T 2: 104,208,183 V1547D probably damaging Het
Dhx9 TCC TC 1: 153,467,051 probably null Het
Dock2 T A 11: 34,239,536 Y1545F probably damaging Het
Eif4e3 T A 6: 99,640,710 I67L probably benign Het
Epor A G 9: 21,961,859 S86P probably benign Het
Esp31 T A 17: 38,641,121 probably null Het
Esrp2 A G 8: 106,132,711 M498T probably damaging Het
F5 T C 1: 164,204,797 I1771T probably benign Het
Fancd2 C A 6: 113,585,477 H1259Q probably benign Het
Gale C A 4: 135,967,837 S341* probably null Het
Ints12 T A 3: 133,098,453 I67N probably benign Het
Kat2b A G 17: 53,670,798 Y791C probably benign Het
Kazn A G 4: 142,210,092 V108A possibly damaging Het
Kcnma1 T C 14: 23,803,160 T109A probably damaging Het
Med13 T C 11: 86,278,566 T1955A probably damaging Het
Megf10 G A 18: 57,189,603 probably null Het
Megf10 A T 18: 57,287,812 S841C probably damaging Het
Mep1a A G 17: 43,491,578 probably null Het
Mrap2 A T 9: 87,182,789 E194D probably damaging Het
Msh2 A G 17: 87,708,578 K546R probably damaging Het
Ndc80 T C 17: 71,521,068 D88G probably damaging Het
Nrip1 A G 16: 76,293,080 F530L probably damaging Het
Olfr1380 T C 11: 49,564,718 S266P probably damaging Het
Olfr1504 A T 19: 13,888,017 H64Q probably damaging Het
Olfr676 A C 7: 105,036,073 I292L probably benign Het
Olfr812 T C 10: 129,842,995 T16A possibly damaging Het
Oxtr C T 6: 112,489,752 G16R probably benign Het
Pdgfrb A T 18: 61,068,757 K464N probably benign Het
Pja2 A T 17: 64,313,030 M1K probably null Het
Pkhd1 A T 1: 20,503,056 N1875K probably damaging Het
Pogz T C 3: 94,880,180 S1360P possibly damaging Het
Proc A T 18: 32,123,459 L385Q probably damaging Het
Ptprm A G 17: 67,095,497 I132T probably benign Het
Rpgr A G X: 10,196,016 S343P probably benign Het
Rsu1 T C 2: 13,170,004 Y225C probably damaging Het
Scyl1 A G 19: 5,770,453 S118P probably damaging Het
Sec61a1 T C 6: 88,506,149 N414D probably benign Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Sema7a A G 9: 57,953,551 D65G probably benign Het
Slc25a45 A G 19: 5,884,436 Y144C probably damaging Het
Slc26a6 A G 9: 108,856,380 Y103C probably damaging Het
Stat3 C T 11: 100,903,674 D270N probably damaging Het
Taar8b T C 10: 24,091,838 S153G probably benign Het
Top1 A G 2: 160,720,965 E697G possibly damaging Het
Trappc11 G A 8: 47,513,766 T470I probably damaging Het
Ttc7b G A 12: 100,500,117 R79C probably damaging Het
Usp29 A G 7: 6,962,480 T441A probably benign Het
Vmn2r110 A T 17: 20,583,767 L182* probably null Het
Zgrf1 T C 3: 127,601,030 I1345T probably benign Het
Zscan25 G T 5: 145,291,005 R493L probably benign Het
Other mutations in Clca3a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01019:Clca3a2 APN 3 144813627 nonsense probably null
IGL01663:Clca3a2 APN 3 144817155 missense probably damaging 0.97
IGL01779:Clca3a2 APN 3 144819378 missense possibly damaging 0.47
IGL02066:Clca3a2 APN 3 144813455 missense probably benign
IGL02301:Clca3a2 APN 3 144806372 missense probably damaging 0.98
IGL02619:Clca3a2 APN 3 144806322 missense probably damaging 1.00
IGL02852:Clca3a2 APN 3 144806343 missense probably damaging 0.98
IGL02901:Clca3a2 APN 3 144816768 missense probably damaging 1.00
IGL03162:Clca3a2 APN 3 144806416 missense probably damaging 1.00
R0032:Clca3a2 UTSW 3 144816733 missense probably benign 0.01
R0244:Clca3a2 UTSW 3 144813898 missense possibly damaging 0.90
R1249:Clca3a2 UTSW 3 144803004 missense possibly damaging 0.80
R1370:Clca3a2 UTSW 3 144813863 splice site probably benign
R1586:Clca3a2 UTSW 3 144810716 missense possibly damaging 0.94
R1776:Clca3a2 UTSW 3 144813920 missense probably damaging 1.00
R1797:Clca3a2 UTSW 3 144797637 missense probably benign 0.01
R1869:Clca3a2 UTSW 3 144806403 missense probably benign 0.44
R1871:Clca3a2 UTSW 3 144797637 missense probably benign 0.01
R1919:Clca3a2 UTSW 3 144810696 missense probably benign
R1923:Clca3a2 UTSW 3 144805730 missense probably damaging 1.00
R2200:Clca3a2 UTSW 3 144813924 missense probably benign 0.10
R2324:Clca3a2 UTSW 3 144806280 critical splice donor site probably null
R2937:Clca3a2 UTSW 3 144813918 missense probably benign 0.06
R3429:Clca3a2 UTSW 3 144806327 missense probably benign 0.07
R3434:Clca3a2 UTSW 3 144808761 unclassified probably benign
R3551:Clca3a2 UTSW 3 144803081 missense probably damaging 1.00
R3952:Clca3a2 UTSW 3 144803061 missense probably damaging 1.00
R4120:Clca3a2 UTSW 3 144810852 missense probably benign 0.25
R4383:Clca3a2 UTSW 3 144806320 missense probably benign 0.02
R4518:Clca3a2 UTSW 3 144808705 missense probably damaging 1.00
R4801:Clca3a2 UTSW 3 144807351 missense possibly damaging 0.95
R4802:Clca3a2 UTSW 3 144807351 missense possibly damaging 0.95
R4816:Clca3a2 UTSW 3 144810852 missense probably benign 0.25
R4934:Clca3a2 UTSW 3 144817931 missense probably damaging 1.00
R4942:Clca3a2 UTSW 3 144806502 missense probably damaging 1.00
R5123:Clca3a2 UTSW 3 144806343 missense probably damaging 1.00
R5156:Clca3a2 UTSW 3 144805838 missense probably benign 0.26
R5275:Clca3a2 UTSW 3 144813579 missense probably damaging 1.00
R5372:Clca3a2 UTSW 3 144797525 missense probably benign 0.00
R5656:Clca3a2 UTSW 3 144797632 missense probably benign 0.26
R6059:Clca3a2 UTSW 3 144810770 missense probably damaging 1.00
R6155:Clca3a2 UTSW 3 144819357 missense probably damaging 0.99
R6254:Clca3a2 UTSW 3 144802134 missense probably benign
R6336:Clca3a2 UTSW 3 144806478 missense probably benign
R6470:Clca3a2 UTSW 3 144804263 unclassified probably null
R6593:Clca3a2 UTSW 3 144808577 critical splice donor site probably null
R6631:Clca3a2 UTSW 3 144813644 missense probably benign
R6826:Clca3a2 UTSW 3 144818054 missense possibly damaging 0.46
R6836:Clca3a2 UTSW 3 144806383 missense probably damaging 0.97
R6896:Clca3a2 UTSW 3 144808701 missense probably damaging 1.00
R7211:Clca3a2 UTSW 3 144814014 missense probably benign 0.00
R7324:Clca3a2 UTSW 3 144808611 missense probably damaging 0.99
R7411:Clca3a2 UTSW 3 144802099 missense probably damaging 1.00
R7486:Clca3a2 UTSW 3 144797601 missense probably damaging 1.00
R7491:Clca3a2 UTSW 3 144813579 missense probably damaging 1.00
R7521:Clca3a2 UTSW 3 144801913 makesense probably null
Predicted Primers PCR Primer
(F):5'- ACTGTACCTCATGTTCCATGG -3'
(R):5'- ATGGAACCACTCCTGGCTAC -3'

Sequencing Primer
(F):5'- CATGTTCCATGGGAAGCATG -3'
(R):5'- GCTACCGCTCACATGAGTCAGAG -3'
Posted On2015-09-25