Incidental Mutation 'R4598:Clca3a2'
ID 345340
Institutional Source Beutler Lab
Gene Symbol Clca3a2
Ensembl Gene ENSMUSG00000028262
Gene Name chloride channel accessory 3A2
Synonyms Clca2
MMRRC Submission 041814-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.097) question?
Stock # R4598 (G1)
Quality Score 225
Status Not validated
Chromosome 3
Chromosomal Location 144502320-144525255 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 144511444 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 41 (N41K)
Ref Sequence ENSEMBL: ENSMUSP00000143543 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029929] [ENSMUST00000199029]
AlphaFold Q9EQR4
Predicted Effect probably damaging
Transcript: ENSMUST00000029929
AA Change: N650K

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000029929
Gene: ENSMUSG00000028262
AA Change: N650K

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
VWA 306 478 1.5e-21 SMART
FN3 758 857 5.49e0 SMART
Predicted Effect unknown
Transcript: ENSMUST00000197013
AA Change: N210K
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198543
Predicted Effect probably damaging
Transcript: ENSMUST00000199029
AA Change: N41K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000143543
Gene: ENSMUSG00000028262
AA Change: N41K

DomainStartEndE-ValueType
Pfam:CLCA 1 188 6.5e-77 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830018L16Rik G A 1: 11,818,188 (GRCm39) probably null Het
Abca14 T C 7: 119,854,626 (GRCm39) V930A probably benign Het
Abcb7 A C X: 103,366,988 (GRCm39) D135E probably benign Het
Ace T A 11: 105,872,585 (GRCm39) probably null Het
Acnat1 T C 4: 49,450,781 (GRCm39) D110G probably benign Het
Ak9 C T 10: 41,259,907 (GRCm39) P862S probably damaging Het
Atp1a3 A G 7: 24,678,766 (GRCm39) S972P probably damaging Het
Bmf C A 2: 118,379,609 (GRCm39) A56S probably benign Het
C6 T C 15: 4,792,852 (GRCm39) L319P possibly damaging Het
Cab39 A G 1: 85,776,050 (GRCm39) Y249C probably damaging Het
Cdc14b T C 13: 64,395,088 (GRCm39) T69A probably benign Het
Cep162 A G 9: 87,085,848 (GRCm39) Y1159H possibly damaging Het
Chrna7 A G 7: 62,753,538 (GRCm39) M327T probably damaging Het
Clock T C 5: 76,383,657 (GRCm39) M499V probably benign Het
Col5a3 A G 9: 20,685,855 (GRCm39) probably null Het
Coq6 T C 12: 84,408,913 (GRCm39) V30A probably benign Het
Cyp3a57 A G 5: 145,327,227 (GRCm39) I473V probably benign Het
D430041D05Rik A T 2: 104,038,528 (GRCm39) V1547D probably damaging Het
Dhx9 TCC TC 1: 153,342,797 (GRCm39) probably null Het
Dock2 T A 11: 34,189,536 (GRCm39) Y1545F probably damaging Het
Eif4e3 T A 6: 99,617,671 (GRCm39) I67L probably benign Het
Epor A G 9: 21,873,155 (GRCm39) S86P probably benign Het
Esp31 T A 17: 38,952,012 (GRCm39) probably null Het
Esrp2 A G 8: 106,859,343 (GRCm39) M498T probably damaging Het
F5 T C 1: 164,032,366 (GRCm39) I1771T probably benign Het
Fancd2 C A 6: 113,562,438 (GRCm39) H1259Q probably benign Het
Gale C A 4: 135,695,148 (GRCm39) S341* probably null Het
Ints12 T A 3: 132,804,214 (GRCm39) I67N probably benign Het
Kat2b A G 17: 53,977,826 (GRCm39) Y791C probably benign Het
Kazn A G 4: 141,937,403 (GRCm39) V108A possibly damaging Het
Kcnma1 T C 14: 23,853,228 (GRCm39) T109A probably damaging Het
Med13 T C 11: 86,169,392 (GRCm39) T1955A probably damaging Het
Megf10 A T 18: 57,420,884 (GRCm39) S841C probably damaging Het
Megf10 G A 18: 57,322,675 (GRCm39) probably null Het
Mep1a A G 17: 43,802,469 (GRCm39) probably null Het
Mrap2 A T 9: 87,064,842 (GRCm39) E194D probably damaging Het
Msh2 A G 17: 88,016,006 (GRCm39) K546R probably damaging Het
Ndc80 T C 17: 71,828,063 (GRCm39) D88G probably damaging Het
Nrip1 A G 16: 76,089,968 (GRCm39) F530L probably damaging Het
Or2y10 T C 11: 49,455,545 (GRCm39) S266P probably damaging Het
Or52e7 A C 7: 104,685,280 (GRCm39) I292L probably benign Het
Or6c216 T C 10: 129,678,864 (GRCm39) T16A possibly damaging Het
Or9i16 A T 19: 13,865,381 (GRCm39) H64Q probably damaging Het
Oxtr C T 6: 112,466,713 (GRCm39) G16R probably benign Het
Pdgfrb A T 18: 61,201,829 (GRCm39) K464N probably benign Het
Pja2 A T 17: 64,620,025 (GRCm39) M1K probably null Het
Pkhd1 A T 1: 20,573,280 (GRCm39) N1875K probably damaging Het
Pogz T C 3: 94,787,491 (GRCm39) S1360P possibly damaging Het
Proc A T 18: 32,256,512 (GRCm39) L385Q probably damaging Het
Ptprm A G 17: 67,402,492 (GRCm39) I132T probably benign Het
Rpgr A G X: 10,062,255 (GRCm39) S343P probably benign Het
Rsu1 T C 2: 13,174,815 (GRCm39) Y225C probably damaging Het
Scyl1 A G 19: 5,820,481 (GRCm39) S118P probably damaging Het
Sec61a1 T C 6: 88,483,131 (GRCm39) N414D probably benign Het
Secisbp2l C T 2: 125,582,657 (GRCm39) G933D possibly damaging Het
Sema7a A G 9: 57,860,834 (GRCm39) D65G probably benign Het
Slc25a45 A G 19: 5,934,464 (GRCm39) Y144C probably damaging Het
Slc26a6 A G 9: 108,733,579 (GRCm39) Y103C probably damaging Het
Stat3 C T 11: 100,794,500 (GRCm39) D270N probably damaging Het
Taar8b T C 10: 23,967,736 (GRCm39) S153G probably benign Het
Top1 A G 2: 160,562,885 (GRCm39) E697G possibly damaging Het
Trappc11 G A 8: 47,966,801 (GRCm39) T470I probably damaging Het
Ttc7b G A 12: 100,466,376 (GRCm39) R79C probably damaging Het
Usp29 A G 7: 6,965,479 (GRCm39) T441A probably benign Het
Vmn2r110 A T 17: 20,804,029 (GRCm39) L182* probably null Het
Zgrf1 T C 3: 127,394,679 (GRCm39) I1345T probably benign Het
Zscan25 G T 5: 145,227,815 (GRCm39) R493L probably benign Het
Other mutations in Clca3a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00419:Clca3a2 APN 3 144,804,574 (GRCm39) missense probably damaging 1.00
IGL01019:Clca3a2 APN 3 144,519,388 (GRCm39) nonsense probably null
IGL01337:Clca3a2 APN 3 144,800,939 (GRCm39) missense probably damaging 1.00
IGL01389:Clca3a2 APN 3 144,783,629 (GRCm39) critical splice donor site probably null
IGL01595:Clca3a2 APN 3 144,793,768 (GRCm39) missense probably damaging 1.00
IGL01663:Clca3a2 APN 3 144,522,916 (GRCm39) missense probably damaging 0.97
IGL01704:Clca3a2 APN 3 144,800,979 (GRCm39) missense probably benign 0.04
IGL01779:Clca3a2 APN 3 144,525,139 (GRCm39) missense possibly damaging 0.47
IGL02066:Clca3a2 APN 3 144,519,216 (GRCm39) missense probably benign
IGL02301:Clca3a2 APN 3 144,512,133 (GRCm39) missense probably damaging 0.98
IGL02416:Clca3a2 APN 3 144,790,777 (GRCm39) missense probably benign 0.02
IGL02455:Clca3a2 APN 3 144,787,172 (GRCm39) missense probably benign 0.00
IGL02481:Clca3a2 APN 3 144,790,701 (GRCm39) missense possibly damaging 0.92
IGL02526:Clca3a2 APN 3 144,793,779 (GRCm39) missense probably benign 0.02
IGL02619:Clca3a2 APN 3 144,512,083 (GRCm39) missense probably damaging 1.00
IGL02797:Clca3a2 APN 3 144,787,024 (GRCm39) missense probably benign 0.02
IGL02852:Clca3a2 APN 3 144,512,104 (GRCm39) missense probably damaging 0.98
IGL02901:Clca3a2 APN 3 144,522,529 (GRCm39) missense probably damaging 1.00
IGL03162:Clca3a2 APN 3 144,512,177 (GRCm39) missense probably damaging 1.00
IGL03253:Clca3a2 APN 3 144,777,324 (GRCm39) missense probably benign 0.41
IGL03256:Clca3a2 APN 3 144,792,153 (GRCm39) missense possibly damaging 0.75
IGL03294:Clca3a2 APN 3 144,803,530 (GRCm39) missense probably damaging 1.00
3370:Clca3a2 UTSW 3 144,783,738 (GRCm39) missense probably damaging 1.00
R0032:Clca3a2 UTSW 3 144,522,494 (GRCm39) missense probably benign 0.01
R0244:Clca3a2 UTSW 3 144,519,659 (GRCm39) missense possibly damaging 0.90
R0479:Clca3a2 UTSW 3 144,796,610 (GRCm39) missense probably damaging 1.00
R0542:Clca3a2 UTSW 3 144,781,571 (GRCm39) splice site probably benign
R0629:Clca3a2 UTSW 3 144,778,000 (GRCm39) missense probably benign
R1249:Clca3a2 UTSW 3 144,508,765 (GRCm39) missense possibly damaging 0.80
R1370:Clca3a2 UTSW 3 144,519,624 (GRCm39) splice site probably benign
R1488:Clca3a2 UTSW 3 144,789,925 (GRCm39) missense possibly damaging 0.49
R1523:Clca3a2 UTSW 3 144,777,405 (GRCm39) nonsense probably null
R1568:Clca3a2 UTSW 3 144,781,410 (GRCm39) nonsense probably null
R1586:Clca3a2 UTSW 3 144,516,477 (GRCm39) missense possibly damaging 0.94
R1650:Clca3a2 UTSW 3 144,797,973 (GRCm39) missense probably damaging 1.00
R1771:Clca3a2 UTSW 3 144,787,171 (GRCm39) missense probably benign 0.12
R1776:Clca3a2 UTSW 3 144,519,681 (GRCm39) missense probably damaging 1.00
R1797:Clca3a2 UTSW 3 144,503,398 (GRCm39) missense probably benign 0.01
R1869:Clca3a2 UTSW 3 144,512,164 (GRCm39) missense probably benign 0.44
R1871:Clca3a2 UTSW 3 144,503,398 (GRCm39) missense probably benign 0.01
R1919:Clca3a2 UTSW 3 144,516,457 (GRCm39) missense probably benign
R1923:Clca3a2 UTSW 3 144,511,491 (GRCm39) missense probably damaging 1.00
R2101:Clca3a2 UTSW 3 144,783,699 (GRCm39) missense probably damaging 0.99
R2200:Clca3a2 UTSW 3 144,519,685 (GRCm39) missense probably benign 0.10
R2242:Clca3a2 UTSW 3 144,796,551 (GRCm39) missense probably damaging 0.98
R2324:Clca3a2 UTSW 3 144,512,041 (GRCm39) critical splice donor site probably null
R2937:Clca3a2 UTSW 3 144,519,679 (GRCm39) missense probably benign 0.06
R3429:Clca3a2 UTSW 3 144,512,088 (GRCm39) missense probably benign 0.07
R3434:Clca3a2 UTSW 3 144,514,522 (GRCm39) unclassified probably benign
R3551:Clca3a2 UTSW 3 144,508,842 (GRCm39) missense probably damaging 1.00
R3751:Clca3a2 UTSW 3 144,777,216 (GRCm39) missense probably benign 0.04
R3952:Clca3a2 UTSW 3 144,508,822 (GRCm39) missense probably damaging 1.00
R4120:Clca3a2 UTSW 3 144,516,613 (GRCm39) missense probably benign 0.25
R4383:Clca3a2 UTSW 3 144,512,081 (GRCm39) missense probably benign 0.02
R4496:Clca3a2 UTSW 3 144,797,926 (GRCm39) missense possibly damaging 0.94
R4518:Clca3a2 UTSW 3 144,514,466 (GRCm39) missense probably damaging 1.00
R4801:Clca3a2 UTSW 3 144,513,112 (GRCm39) missense possibly damaging 0.95
R4802:Clca3a2 UTSW 3 144,513,112 (GRCm39) missense possibly damaging 0.95
R4816:Clca3a2 UTSW 3 144,516,613 (GRCm39) missense probably benign 0.25
R4934:Clca3a2 UTSW 3 144,523,692 (GRCm39) missense probably damaging 1.00
R4942:Clca3a2 UTSW 3 144,512,263 (GRCm39) missense probably damaging 1.00
R4962:Clca3a2 UTSW 3 144,783,640 (GRCm39) missense probably damaging 1.00
R5123:Clca3a2 UTSW 3 144,512,104 (GRCm39) missense probably damaging 1.00
R5156:Clca3a2 UTSW 3 144,511,599 (GRCm39) missense probably benign 0.26
R5275:Clca3a2 UTSW 3 144,519,340 (GRCm39) missense probably damaging 1.00
R5344:Clca3a2 UTSW 3 144,793,703 (GRCm39) missense probably damaging 1.00
R5372:Clca3a2 UTSW 3 144,503,286 (GRCm39) missense probably benign 0.00
R5424:Clca3a2 UTSW 3 144,789,942 (GRCm39) missense probably damaging 0.99
R5656:Clca3a2 UTSW 3 144,503,393 (GRCm39) missense probably benign 0.26
R5931:Clca3a2 UTSW 3 144,797,886 (GRCm39) missense possibly damaging 0.88
R6059:Clca3a2 UTSW 3 144,516,531 (GRCm39) missense probably damaging 1.00
R6155:Clca3a2 UTSW 3 144,525,118 (GRCm39) missense probably damaging 0.99
R6181:Clca3a2 UTSW 3 144,796,469 (GRCm39) nonsense probably null
R6254:Clca3a2 UTSW 3 144,507,895 (GRCm39) missense probably benign
R6336:Clca3a2 UTSW 3 144,512,239 (GRCm39) missense probably benign
R6470:Clca3a2 UTSW 3 144,510,024 (GRCm39) splice site probably null
R6593:Clca3a2 UTSW 3 144,514,338 (GRCm39) critical splice donor site probably null
R6598:Clca3a2 UTSW 3 144,792,246 (GRCm39) nonsense probably null
R6631:Clca3a2 UTSW 3 144,519,405 (GRCm39) missense probably benign
R6826:Clca3a2 UTSW 3 144,523,815 (GRCm39) missense possibly damaging 0.46
R6836:Clca3a2 UTSW 3 144,512,144 (GRCm39) missense probably damaging 0.97
R6896:Clca3a2 UTSW 3 144,514,462 (GRCm39) missense probably damaging 1.00
R7167:Clca3a2 UTSW 3 144,803,545 (GRCm39) missense probably benign 0.40
R7211:Clca3a2 UTSW 3 144,519,775 (GRCm39) missense probably benign 0.00
R7229:Clca3a2 UTSW 3 144,789,869 (GRCm39) missense probably damaging 1.00
R7256:Clca3a2 UTSW 3 144,796,608 (GRCm39) missense probably damaging 0.99
R7324:Clca3a2 UTSW 3 144,514,372 (GRCm39) missense probably damaging 0.99
R7365:Clca3a2 UTSW 3 144,804,545 (GRCm39) missense probably damaging 1.00
R7411:Clca3a2 UTSW 3 144,507,860 (GRCm39) missense probably damaging 1.00
R7486:Clca3a2 UTSW 3 144,503,362 (GRCm39) missense probably damaging 1.00
R7491:Clca3a2 UTSW 3 144,519,340 (GRCm39) missense probably damaging 1.00
R7521:Clca3a2 UTSW 3 144,507,674 (GRCm39) makesense probably null
R7813:Clca3a2 UTSW 3 144,790,726 (GRCm39) missense probably benign 0.26
R7889:Clca3a2 UTSW 3 144,516,574 (GRCm39) nonsense probably null
R7946:Clca3a2 UTSW 3 144,513,075 (GRCm39) critical splice donor site probably null
R7991:Clca3a2 UTSW 3 144,519,756 (GRCm39) missense probably benign 0.00
R8022:Clca3a2 UTSW 3 144,511,527 (GRCm39) missense probably damaging 1.00
R8077:Clca3a2 UTSW 3 144,777,288 (GRCm39) missense possibly damaging 0.56
R8169:Clca3a2 UTSW 3 144,783,653 (GRCm39) missense probably damaging 1.00
R8290:Clca3a2 UTSW 3 144,793,719 (GRCm39) missense possibly damaging 0.93
R8300:Clca3a2 UTSW 3 144,804,692 (GRCm39) missense probably benign 0.00
R8344:Clca3a2 UTSW 3 144,511,703 (GRCm39) critical splice acceptor site probably null
R8350:Clca3a2 UTSW 3 144,783,668 (GRCm39) missense probably benign 0.19
R8367:Clca3a2 UTSW 3 144,523,508 (GRCm39) splice site probably null
R8371:Clca3a2 UTSW 3 144,513,114 (GRCm39) nonsense probably null
R8814:Clca3a2 UTSW 3 144,503,525 (GRCm39) missense probably benign 0.18
R8854:Clca3a2 UTSW 3 144,783,852 (GRCm39) missense possibly damaging 0.94
R8876:Clca3a2 UTSW 3 144,777,360 (GRCm39) missense probably benign 0.00
R8887:Clca3a2 UTSW 3 144,790,810 (GRCm39) nonsense probably null
R9006:Clca3a2 UTSW 3 144,783,789 (GRCm39) missense probably damaging 0.99
R9031:Clca3a2 UTSW 3 144,511,475 (GRCm39) missense probably damaging 1.00
R9069:Clca3a2 UTSW 3 144,519,447 (GRCm39) splice site probably benign
R9093:Clca3a2 UTSW 3 144,781,481 (GRCm39) missense probably benign 0.20
R9190:Clca3a2 UTSW 3 144,796,599 (GRCm39) missense probably benign 0.00
R9201:Clca3a2 UTSW 3 144,519,684 (GRCm39) missense probably benign 0.00
R9209:Clca3a2 UTSW 3 144,778,005 (GRCm39) missense probably benign 0.00
R9261:Clca3a2 UTSW 3 144,525,158 (GRCm39) missense probably benign
R9469:Clca3a2 UTSW 3 144,507,938 (GRCm39) missense probably damaging 1.00
R9501:Clca3a2 UTSW 3 144,777,322 (GRCm39) nonsense probably null
R9515:Clca3a2 UTSW 3 144,508,808 (GRCm39) nonsense probably null
R9569:Clca3a2 UTSW 3 144,513,075 (GRCm39) critical splice donor site probably null
R9664:Clca3a2 UTSW 3 144,503,575 (GRCm39) missense probably damaging 1.00
X0025:Clca3a2 UTSW 3 144,792,265 (GRCm39) missense possibly damaging 0.87
Z1177:Clca3a2 UTSW 3 144,792,212 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTGTACCTCATGTTCCATGG -3'
(R):5'- ATGGAACCACTCCTGGCTAC -3'

Sequencing Primer
(F):5'- CATGTTCCATGGGAAGCATG -3'
(R):5'- GCTACCGCTCACATGAGTCAGAG -3'
Posted On 2015-09-25