Incidental Mutation 'R0254:L1td1'
ID 34536
Institutional Source Beutler Lab
Gene Symbol L1td1
Ensembl Gene ENSMUSG00000087166
Gene Name LINE-1 type transposase domain containing 1
Synonyms ECAT11
MMRRC Submission 038485-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.086) question?
Stock # R0254 (G1)
Quality Score 225
Status Validated
Chromosome 4
Chromosomal Location 98614991-98626723 bp(+) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) T to A at 98625419 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Stop codon at position 538 (L538*)
Ref Sequence ENSEMBL: ENSMUSP00000134149 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000152889] [ENSMUST00000154279] [ENSMUST00000171708] [ENSMUST00000173659]
AlphaFold Q587J6
Predicted Effect probably benign
Transcript: ENSMUST00000152889
Predicted Effect probably null
Transcript: ENSMUST00000154279
AA Change: L472*
SMART Domains Protein: ENSMUSP00000127504
Gene: ENSMUSG00000087166
AA Change: L472*

DomainStartEndE-ValueType
Pfam:Transposase_22 175 295 4e-21 PFAM
low complexity region 346 397 N/A INTRINSIC
low complexity region 402 413 N/A INTRINSIC
Pfam:Transposase_22 495 782 2.2e-59 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000171708
Predicted Effect probably null
Transcript: ENSMUST00000173659
AA Change: L538*
SMART Domains Protein: ENSMUSP00000134149
Gene: ENSMUSG00000087166
AA Change: L538*

DomainStartEndE-ValueType
Pfam:Transposase_22 175 291 6e-20 PFAM
coiled coil region 383 431 N/A INTRINSIC
low complexity region 468 479 N/A INTRINSIC
Pfam:Transposase_22 568 848 4.3e-57 PFAM
Meta Mutation Damage Score 0.9700 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.1%
  • 20x: 91.7%
Validation Efficiency 100% (100/100)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal development and fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700034J05Rik T A 6: 146,853,902 (GRCm39) M252L probably benign Het
Abca6 A G 11: 110,127,615 (GRCm39) V314A probably benign Het
Abcb1b A T 5: 8,877,409 (GRCm39) E656D probably benign Het
Abhd4 T C 14: 54,500,691 (GRCm39) I160T probably benign Het
Aco2 T C 15: 81,773,557 (GRCm39) V32A probably damaging Het
Actl6b A G 5: 137,552,406 (GRCm39) probably benign Het
Akap13 T C 7: 75,386,352 (GRCm39) probably benign Het
Alpk3 A T 7: 80,726,722 (GRCm39) T136S probably benign Het
Ap1g1 G T 8: 110,529,749 (GRCm39) M56I probably benign Het
Arid2 C T 15: 96,268,452 (GRCm39) T855I probably damaging Het
Asprv1 T C 6: 86,606,077 (GRCm39) F308L probably damaging Het
Ass1 A T 2: 31,404,831 (GRCm39) N371Y probably damaging Het
Atp11b T A 3: 35,866,259 (GRCm39) M378K possibly damaging Het
Atp1a3 T C 7: 24,680,937 (GRCm39) probably benign Het
Blk C A 14: 63,618,253 (GRCm39) A218S probably benign Het
C4b T A 17: 34,953,750 (GRCm39) T953S probably benign Het
Cdadc1 T C 14: 59,813,356 (GRCm39) probably benign Het
Cdca2 C A 14: 67,914,627 (GRCm39) L877F probably damaging Het
Ceacam10 G T 7: 24,477,733 (GRCm39) V83L probably damaging Het
Cep290 A T 10: 100,350,436 (GRCm39) I677F probably benign Het
Clip1 A T 5: 123,755,395 (GRCm39) probably benign Het
Col11a2 G T 17: 34,283,777 (GRCm39) probably benign Het
Coro1c A T 5: 113,983,313 (GRCm39) V405D probably benign Het
Crebrf A G 17: 26,958,568 (GRCm39) T13A probably benign Het
Cspg4 A G 9: 56,804,694 (GRCm39) E1835G probably damaging Het
Cubn A T 2: 13,480,846 (GRCm39) probably null Het
Cubn T C 2: 13,429,505 (GRCm39) N1332S probably benign Het
Cubn T C 2: 13,445,325 (GRCm39) T1014A possibly damaging Het
Efnb1 T C X: 98,180,634 (GRCm39) probably benign Het
Elf2 G T 3: 51,215,611 (GRCm39) P33Q probably damaging Het
Fap C T 2: 62,333,746 (GRCm39) G633D probably damaging Het
Gm10288 T C 3: 146,544,675 (GRCm39) noncoding transcript Het
Got2 T C 8: 96,596,166 (GRCm39) N318S probably benign Het
Guk1 A T 11: 59,076,854 (GRCm39) F76L probably damaging Het
H2-K2 A T 17: 34,215,639 (GRCm39) probably benign Het
Helz2 C A 2: 180,874,552 (GRCm39) G1981C probably damaging Het
Hinfp G A 9: 44,209,536 (GRCm39) H250Y probably damaging Het
Hnrnpm C T 17: 33,871,242 (GRCm39) probably null Het
Hsd11b2 T A 8: 106,249,699 (GRCm39) V270E possibly damaging Het
Igbp1b A T 6: 138,635,201 (GRCm39) M81K probably damaging Het
Kif11 A G 19: 37,399,957 (GRCm39) T815A probably benign Het
Kit G A 5: 75,781,581 (GRCm39) V337I probably benign Het
Klf11 T C 12: 24,703,582 (GRCm39) S6P probably damaging Het
Klk13 T C 7: 43,373,245 (GRCm39) V193A probably benign Het
Krt73 T A 15: 101,708,324 (GRCm39) probably benign Het
Macf1 A G 4: 123,326,572 (GRCm39) L2061P probably damaging Het
Mcm2 A G 6: 88,860,998 (GRCm39) I900T probably damaging Het
Med16 A T 10: 79,736,034 (GRCm39) N371K possibly damaging Het
Mepce A C 5: 137,783,698 (GRCm39) D209E possibly damaging Het
Mrc2 C G 11: 105,238,692 (GRCm39) P1249R probably benign Het
Mx2 A T 16: 97,357,295 (GRCm39) I463L probably benign Het
Naaa A T 5: 92,412,994 (GRCm39) N73K probably damaging Het
Nags T A 11: 102,038,771 (GRCm39) L404Q probably damaging Het
Neb A G 2: 52,133,402 (GRCm39) Y3379H probably damaging Het
Nhsl1 A G 10: 18,348,733 (GRCm39) E120G probably damaging Het
Or11j4 T C 14: 50,630,536 (GRCm39) S108P probably damaging Het
Or4f53 A C 2: 111,087,466 (GRCm39) N2T probably benign Het
Or51a42 T C 7: 103,708,728 (GRCm39) H27R probably benign Het
Or51ah3 T A 7: 103,209,829 (GRCm39) Y48* probably null Het
Or51f5 C A 7: 102,424,076 (GRCm39) S115* probably null Het
Pcnt A G 10: 76,228,414 (GRCm39) F1584L probably benign Het
Pdgfra G A 5: 75,328,596 (GRCm39) V243I probably damaging Het
Polr2a T C 11: 69,634,497 (GRCm39) I689V possibly damaging Het
Ppfia4 C A 1: 134,251,962 (GRCm39) probably benign Het
Prmt8 C A 6: 127,688,771 (GRCm39) V200L probably damaging Het
Prpf8 T A 11: 75,397,188 (GRCm39) I2007N possibly damaging Het
Ptpn6 T C 6: 124,705,113 (GRCm39) E230G probably damaging Het
R3hcc1l G A 19: 42,551,587 (GRCm39) V195I probably damaging Het
Rb1cc1 C T 1: 6,333,071 (GRCm39) T1330I probably damaging Het
Reep3 G T 10: 66,857,575 (GRCm39) T172N probably benign Het
Rfwd3 A G 8: 112,020,655 (GRCm39) V236A probably benign Het
Rgs22 T C 15: 36,104,698 (GRCm39) I121V probably damaging Het
Robo1 T A 16: 72,461,058 (GRCm39) F11I probably benign Het
Rsrc2 A G 5: 123,878,910 (GRCm39) probably benign Het
Rubcn A G 16: 32,668,316 (GRCm39) V117A probably benign Het
Scamp1 T G 13: 94,347,088 (GRCm39) N192T probably benign Het
Scn8a T A 15: 100,916,245 (GRCm39) I1218N probably damaging Het
Serinc1 A G 10: 57,399,304 (GRCm39) S200P probably damaging Het
Serpinb9f T A 13: 33,518,574 (GRCm39) F358Y probably damaging Het
Slc12a5 T C 2: 164,839,165 (GRCm39) probably null Het
Slc5a4b T C 10: 75,906,462 (GRCm39) M386V possibly damaging Het
Smarca5 A G 8: 81,431,329 (GRCm39) F963L probably benign Het
Smchd1 A T 17: 71,718,886 (GRCm39) F828I probably benign Het
Smr2l A T 5: 88,430,230 (GRCm39) H42L possibly damaging Het
Stab2 G T 10: 86,733,824 (GRCm39) Q1333K probably benign Het
Svop T C 5: 114,176,600 (GRCm39) S349G probably benign Het
Tdrd1 G A 19: 56,830,998 (GRCm39) S271N probably benign Het
Tec G A 5: 72,941,081 (GRCm39) P159S probably benign Het
Tec T C 5: 72,920,899 (GRCm39) probably benign Het
Tfip11 G A 5: 112,483,521 (GRCm39) M645I probably benign Het
Thap12 A T 7: 98,364,488 (GRCm39) T219S probably benign Het
Tmem87a C T 2: 120,205,988 (GRCm39) R329H probably damaging Het
Tpsab1 A G 17: 25,562,719 (GRCm39) Y227H probably damaging Het
Urah G A 7: 140,417,602 (GRCm39) V114I probably benign Het
Wnt5a G A 14: 28,244,811 (GRCm39) E353K probably damaging Het
Zfp1004 G A 2: 150,033,784 (GRCm39) R35K possibly damaging Het
Zfp101 A T 17: 33,599,952 (GRCm39) H601Q possibly damaging Het
Other mutations in L1td1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01599:L1td1 APN 4 98,625,581 (GRCm39) missense probably damaging 0.99
IGL02529:L1td1 APN 4 98,625,658 (GRCm39) missense probably benign 0.01
R0924:L1td1 UTSW 4 98,625,862 (GRCm39) missense probably damaging 1.00
R0930:L1td1 UTSW 4 98,625,862 (GRCm39) missense probably damaging 1.00
R1434:L1td1 UTSW 4 98,626,054 (GRCm39) missense possibly damaging 0.91
R1573:L1td1 UTSW 4 98,625,517 (GRCm39) missense probably benign 0.01
R1751:L1td1 UTSW 4 98,625,686 (GRCm39) missense probably benign 0.32
R1767:L1td1 UTSW 4 98,625,686 (GRCm39) missense probably benign 0.32
R1870:L1td1 UTSW 4 98,625,714 (GRCm39) missense possibly damaging 0.93
R2006:L1td1 UTSW 4 98,621,726 (GRCm39) missense possibly damaging 0.53
R2252:L1td1 UTSW 4 98,625,874 (GRCm39) splice site probably null
R2383:L1td1 UTSW 4 98,625,959 (GRCm39) missense possibly damaging 0.93
R2472:L1td1 UTSW 4 98,621,396 (GRCm39) unclassified probably benign
R3195:L1td1 UTSW 4 98,625,755 (GRCm39) missense possibly damaging 0.47
R3763:L1td1 UTSW 4 98,626,072 (GRCm39) missense probably damaging 0.99
R3950:L1td1 UTSW 4 98,625,590 (GRCm39) missense probably benign 0.12
R3962:L1td1 UTSW 4 98,625,686 (GRCm39) missense probably benign 0.32
R4430:L1td1 UTSW 4 98,625,388 (GRCm39) missense probably benign 0.00
R4643:L1td1 UTSW 4 98,626,120 (GRCm39) missense probably damaging 0.98
R4661:L1td1 UTSW 4 98,621,861 (GRCm39) missense possibly damaging 0.94
R4885:L1td1 UTSW 4 98,625,548 (GRCm39) missense probably benign 0.01
R5345:L1td1 UTSW 4 98,624,684 (GRCm39) missense probably damaging 1.00
R5589:L1td1 UTSW 4 98,626,341 (GRCm39) missense possibly damaging 0.66
R5800:L1td1 UTSW 4 98,621,999 (GRCm39) missense possibly damaging 0.96
R6207:L1td1 UTSW 4 98,625,655 (GRCm39) missense possibly damaging 0.55
R6309:L1td1 UTSW 4 98,625,328 (GRCm39) missense probably damaging 0.99
R6917:L1td1 UTSW 4 98,622,268 (GRCm39) missense probably benign 0.18
R6945:L1td1 UTSW 4 98,621,933 (GRCm39) missense probably benign 0.33
R7185:L1td1 UTSW 4 98,624,855 (GRCm39) missense possibly damaging 0.72
R7258:L1td1 UTSW 4 98,625,101 (GRCm39) missense probably benign 0.04
R7893:L1td1 UTSW 4 98,621,978 (GRCm39) missense possibly damaging 0.73
R8129:L1td1 UTSW 4 98,621,563 (GRCm39) missense probably benign 0.01
R8430:L1td1 UTSW 4 98,626,109 (GRCm39) missense probably damaging 1.00
R8485:L1td1 UTSW 4 98,625,911 (GRCm39) missense probably damaging 1.00
R8486:L1td1 UTSW 4 98,625,911 (GRCm39) missense probably damaging 1.00
R8549:L1td1 UTSW 4 98,626,280 (GRCm39) missense probably damaging 1.00
R8726:L1td1 UTSW 4 98,622,215 (GRCm39) missense probably damaging 0.98
R8787:L1td1 UTSW 4 98,625,814 (GRCm39) missense probably benign 0.06
R8920:L1td1 UTSW 4 98,624,864 (GRCm39) nonsense probably null
R8921:L1td1 UTSW 4 98,622,175 (GRCm39) missense possibly damaging 0.71
R9087:L1td1 UTSW 4 98,624,699 (GRCm39) missense possibly damaging 0.85
R9228:L1td1 UTSW 4 98,625,932 (GRCm39) missense possibly damaging 0.66
R9486:L1td1 UTSW 4 98,624,899 (GRCm39) missense probably benign
R9656:L1td1 UTSW 4 98,622,223 (GRCm39) missense probably benign 0.32
R9766:L1td1 UTSW 4 98,624,753 (GRCm39) missense probably benign 0.33
RF019:L1td1 UTSW 4 98,625,061 (GRCm39) missense not run
RF031:L1td1 UTSW 4 98,625,026 (GRCm39) small deletion probably benign
RF039:L1td1 UTSW 4 98,625,026 (GRCm39) small deletion probably benign
RF060:L1td1 UTSW 4 98,625,031 (GRCm39) small deletion probably benign
Predicted Primers PCR Primer
(F):5'- GCCTCCATACGAAGCGAAGTTCTG -3'
(R):5'- AACACTGATCACGCCTCTCTTGAAG -3'

Sequencing Primer
(F):5'- TCACCAGGAGTGCTGAGG -3'
(R):5'- tttcttcggtttcaaggatcaag -3'
Posted On 2013-05-09