Mutagenetix > Incidental Mutation

Incidental Mutation 'R4598:Col5a3'

345363

Institutional Source

Beutler Lab

Gene Symbol

Col5a3

Ensembl Gene

ENSMUSG00000004098

Gene Name

collagen, type V, alpha 3

Synonyms

Pro-alpha3(V)

MMRRC Submission

041814-MU

Accession Numbers

Ncbi RefSeq: NM_016919.2; MGI:1858212

Essential gene?

Possibly non essential (E-score: 0.275) question?

Stock #

R4598 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

20770050-20815067 bp(-) (GRCm38)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

A to G at 20774559 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000004201 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000004201]

AlphaFold

Q9JLI2

Predicted Effect

probably null
Transcript: ENSMUST00000004201

SMART Domains

Protein: ENSMUSP00000004201
Gene: ENSMUSG00000004098

Domain	Start	End	E-Value	Type
signal peptide	1	29	N/A	INTRINSIC
TSPN	32	211	7.08e-28	SMART
LamG	89	210	2.13e-2	SMART
low complexity region	247	267	N/A	INTRINSIC
low complexity region	295	314	N/A	INTRINSIC
low complexity region	341	347	N/A	INTRINSIC
low complexity region	369	381	N/A	INTRINSIC
low complexity region	391	434	N/A	INTRINSIC
low complexity region	461	474	N/A	INTRINSIC
Pfam:Collagen	475	538	5.5e-10	PFAM
low complexity region	597	616	N/A	INTRINSIC
low complexity region	628	694	N/A	INTRINSIC
internal_repeat_3	703	737	7.13e-16	PROSPERO
low complexity region	742	821	N/A	INTRINSIC
low complexity region	823	844	N/A	INTRINSIC
low complexity region	859	889	N/A	INTRINSIC
internal_repeat_2	892	1081	5.05e-17	PROSPERO
internal_repeat_1	996	1133	7.47e-22	PROSPERO
internal_repeat_3	1105	1139	7.13e-16	PROSPERO
low complexity region	1140	1165	N/A	INTRINSIC
low complexity region	1168	1255	N/A	INTRINSIC
low complexity region	1258	1282	N/A	INTRINSIC
low complexity region	1285	1306	N/A	INTRINSIC
low complexity region	1311	1418	N/A	INTRINSIC
Pfam:Collagen	1429	1491	9.5e-10	PFAM
COLFI	1508	1738	7.98e-92	SMART

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 95.1%

Validation Efficiency

MGI Phenotype

Strain: 5000519
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an alpha chain for one of the low abundance fibrillar collagens. Fibrillar collagen molecules are trimers that can be composed of one or more types of alpha chains. Type V collagen is found in tissues containing type I collagen and appears to regulate the assembly of heterotypic fibers composed of both type I and type V collagen. This gene product is closely related to type XI collagen and it is possible that the collagen chains of types V and XI constitute a single collagen type with tissue-specific chain combinations. Mutations in this gene are thought to be responsible for the symptoms of a subset of patients with Ehlers-Danlos syndrome type III. Messages of several sizes can be detected in northern blots but sequence information cannot confirm the identity of the shorter messages. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation show decreased pancreatic beta cell mass, hyperglycemia, hypoinsulinemia, impaired glucose tolerance, insulin resistance and impaired glucose uptake. Homozygous females show decreased susceptibility to diet-induced obesity and a thin hypodermal fat layer. [provided by MGI curators]

Allele List at MGI

All alleles(3) : Targeted(3)

Other mutations in this stock

Total: 67 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A830018L16Rik	G	A	1: 11,747,964		probably null	Het
Abca14	T	C	7: 120,255,403	V930A	probably benign	Het
Abcb7	A	C	X: 104,323,382	D135E	probably benign	Het
Ace	T	A	11: 105,981,759		probably null	Het
Acnat1	T	C	4: 49,450,781	D110G	probably benign	Het
Ak9	C	T	10: 41,383,911	P862S	probably damaging	Het
Atp1a3	A	G	7: 24,979,341	S972P	probably damaging	Het
Bmf	C	A	2: 118,549,128	A56S	probably benign	Het
C6	T	C	15: 4,763,370	L319P	possibly damaging	Het
Cab39	A	G	1: 85,848,329	Y249C	probably damaging	Het
Cdc14b	T	C	13: 64,247,274	T69A	probably benign	Het
Cep162	A	G	9: 87,203,795	Y1159H	possibly damaging	Het
Chrna7	A	G	7: 63,103,790	M327T	probably damaging	Het
Clca3a2	A	T	3: 144,805,683	N41K	probably damaging	Het
Clock	T	C	5: 76,235,810	M499V	probably benign	Het
Coq6	T	C	12: 84,362,139	V30A	probably benign	Het
Cyp3a57	A	G	5: 145,390,417	I473V	probably benign	Het
D430041D05Rik	A	T	2: 104,208,183	V1547D	probably damaging	Het
Dhx9	TCC	TC	1: 153,467,051		probably null	Het
Dock2	T	A	11: 34,239,536	Y1545F	probably damaging	Het
Eif4e3	T	A	6: 99,640,710	I67L	probably benign	Het
Epor	A	G	9: 21,961,859	S86P	probably benign	Het
Esp31	T	A	17: 38,641,121		probably null	Het
Esrp2	A	G	8: 106,132,711	M498T	probably damaging	Het
F5	T	C	1: 164,204,797	I1771T	probably benign	Het
Fancd2	C	A	6: 113,585,477	H1259Q	probably benign	Het
Gale	C	A	4: 135,967,837	S341*	probably null	Het
Ints12	T	A	3: 133,098,453	I67N	probably benign	Het
Kat2b	A	G	17: 53,670,798	Y791C	probably benign	Het
Kazn	A	G	4: 142,210,092	V108A	possibly damaging	Het
Kcnma1	T	C	14: 23,803,160	T109A	probably damaging	Het
Med13	T	C	11: 86,278,566	T1955A	probably damaging	Het
Megf10	G	A	18: 57,189,603		probably null	Het
Megf10	A	T	18: 57,287,812	S841C	probably damaging	Het
Mep1a	A	G	17: 43,491,578		probably null	Het
Mrap2	A	T	9: 87,182,789	E194D	probably damaging	Het
Msh2	A	G	17: 87,708,578	K546R	probably damaging	Het
Ndc80	T	C	17: 71,521,068	D88G	probably damaging	Het
Nrip1	A	G	16: 76,293,080	F530L	probably damaging	Het
Olfr1380	T	C	11: 49,564,718	S266P	probably damaging	Het
Olfr1504	A	T	19: 13,888,017	H64Q	probably damaging	Het
Olfr676	A	C	7: 105,036,073	I292L	probably benign	Het
Olfr812	T	C	10: 129,842,995	T16A	possibly damaging	Het
Oxtr	C	T	6: 112,489,752	G16R	probably benign	Het
Pdgfrb	A	T	18: 61,068,757	K464N	probably benign	Het
Pja2	A	T	17: 64,313,030	M1K	probably null	Het
Pkhd1	A	T	1: 20,503,056	N1875K	probably damaging	Het
Pogz	T	C	3: 94,880,180	S1360P	possibly damaging	Het
Proc	A	T	18: 32,123,459	L385Q	probably damaging	Het
Ptprm	A	G	17: 67,095,497	I132T	probably benign	Het
Rpgr	A	G	X: 10,196,016	S343P	probably benign	Het
Rsu1	T	C	2: 13,170,004	Y225C	probably damaging	Het
Scyl1	A	G	19: 5,770,453	S118P	probably damaging	Het
Sec61a1	T	C	6: 88,506,149	N414D	probably benign	Het
Secisbp2l	C	T	2: 125,740,737	G933D	possibly damaging	Het
Sema7a	A	G	9: 57,953,551	D65G	probably benign	Het
Slc25a45	A	G	19: 5,884,436	Y144C	probably damaging	Het
Slc26a6	A	G	9: 108,856,380	Y103C	probably damaging	Het
Stat3	C	T	11: 100,903,674	D270N	probably damaging	Het
Taar8b	T	C	10: 24,091,838	S153G	probably benign	Het
Top1	A	G	2: 160,720,965	E697G	possibly damaging	Het
Trappc11	G	A	8: 47,513,766	T470I	probably damaging	Het
Ttc7b	G	A	12: 100,500,117	R79C	probably damaging	Het
Usp29	A	G	7: 6,962,480	T441A	probably benign	Het
Vmn2r110	A	T	17: 20,583,767	L182*	probably null	Het
Zgrf1	T	C	3: 127,601,030	I1345T	probably benign	Het
Zscan25	G	T	5: 145,291,005	R493L	probably benign	Het

Other mutations in Col5a3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00834:Col5a3	APN	9	20786389	nonsense	probably null
IGL01548:Col5a3	APN	9	20803000	splice site	probably benign
IGL02164:Col5a3	APN	9	20792643	critical splice donor site	probably null
IGL02297:Col5a3	APN	9	20772154	missense	unknown
IGL02333:Col5a3	APN	9	20799306	missense	unknown
IGL02349:Col5a3	APN	9	20772361	missense	unknown
IGL02390:Col5a3	APN	9	20776996	missense	unknown
IGL02685:Col5a3	APN	9	20772205	missense	unknown
IGL02941:Col5a3	APN	9	20804666	missense	unknown
IGL03001:Col5a3	APN	9	20807744	missense	unknown
IGL03061:Col5a3	APN	9	20797572	critical splice donor site	probably null
IGL03102:Col5a3	APN	9	20804635	critical splice donor site	probably null
IGL03308:Col5a3	APN	9	20808379	missense	unknown
IGL03372:Col5a3	APN	9	20775328	missense	unknown
Guppy	UTSW	9	20779033	missense	probably damaging	1.00
minifish	UTSW	9	20785586	missense	probably damaging	0.99
R0002:Col5a3	UTSW	9	20809856	critical splice acceptor site	probably null
R0012:Col5a3	UTSW	9	20777108	splice site	probably benign
R0316:Col5a3	UTSW	9	20775325	missense	unknown
R0357:Col5a3	UTSW	9	20807768	splice site	probably benign
R0360:Col5a3	UTSW	9	20772466	missense	unknown
R0483:Col5a3	UTSW	9	20782481	splice site	probably null
R0485:Col5a3	UTSW	9	20782708	missense	probably damaging	0.99
R0627:Col5a3	UTSW	9	20775485	missense	unknown
R1035:Col5a3	UTSW	9	20793499	splice site	probably benign
R1051:Col5a3	UTSW	9	20775235	missense	unknown
R1295:Col5a3	UTSW	9	20808418	missense	unknown
R1438:Col5a3	UTSW	9	20779957	missense	probably damaging	0.99
R1622:Col5a3	UTSW	9	20772220	missense	unknown
R1668:Col5a3	UTSW	9	20771096	missense	unknown
R1680:Col5a3	UTSW	9	20784668	critical splice donor site	probably null
R2112:Col5a3	UTSW	9	20809777	missense	unknown
R2149:Col5a3	UTSW	9	20771270	missense	unknown
R2159:Col5a3	UTSW	9	20771310	missense	unknown
R2939:Col5a3	UTSW	9	20795658	missense	unknown
R3236:Col5a3	UTSW	9	20807653	missense	unknown
R3845:Col5a3	UTSW	9	20808377	missense	unknown
R4599:Col5a3	UTSW	9	20774559	critical splice donor site	probably null
R4611:Col5a3	UTSW	9	20814896	unclassified	probably benign
R4713:Col5a3	UTSW	9	20793574	missense	unknown
R4723:Col5a3	UTSW	9	20809591	missense	unknown
R5209:Col5a3	UTSW	9	20778643	intron	probably benign
R5336:Col5a3	UTSW	9	20799301	missense	unknown
R5378:Col5a3	UTSW	9	20797576	missense	unknown
R5614:Col5a3	UTSW	9	20783476	splice site	probably benign
R5775:Col5a3	UTSW	9	20801072	missense	unknown
R5895:Col5a3	UTSW	9	20772442	missense	unknown
R6048:Col5a3	UTSW	9	20807619	missense	unknown
R6265:Col5a3	UTSW	9	20793764	missense	unknown
R6372:Col5a3	UTSW	9	20785586	missense	probably damaging	0.99
R6520:Col5a3	UTSW	9	20774052	missense	unknown
R6558:Col5a3	UTSW	9	20779033	missense	probably damaging	1.00
R6608:Col5a3	UTSW	9	20774019	missense	unknown
R6679:Col5a3	UTSW	9	20779033	missense	probably damaging	1.00
R6680:Col5a3	UTSW	9	20779033	missense	probably damaging	1.00
R6696:Col5a3	UTSW	9	20779033	missense	probably damaging	1.00
R6698:Col5a3	UTSW	9	20779033	missense	probably damaging	1.00
R6700:Col5a3	UTSW	9	20779033	missense	probably damaging	1.00
R6708:Col5a3	UTSW	9	20775035	missense	unknown
R6712:Col5a3	UTSW	9	20779033	missense	probably damaging	1.00
R6714:Col5a3	UTSW	9	20779033	missense	probably damaging	1.00
R6828:Col5a3	UTSW	9	20798452	missense	unknown
R7343:Col5a3	UTSW	9	20793946	critical splice donor site	probably null
R7431:Col5a3	UTSW	9	20770835	makesense	probably null
R7500:Col5a3	UTSW	9	20800289	missense	unknown
R7592:Col5a3	UTSW	9	20797393	missense	unknown
R7671:Col5a3	UTSW	9	20775086	critical splice acceptor site	probably null
R7957:Col5a3	UTSW	9	20774051	missense	unknown
R8510:Col5a3	UTSW	9	20793732	missense	unknown
R8979:Col5a3	UTSW	9	20775301	missense	unknown
R9050:Col5a3	UTSW	9	20786395	missense	probably damaging	1.00
R9052:Col5a3	UTSW	9	20799437	missense	unknown
R9072:Col5a3	UTSW	9	20771157	missense	unknown
R9341:Col5a3	UTSW	9	20793613	missense	unknown
R9343:Col5a3	UTSW	9	20793613	missense	unknown
R9529:Col5a3	UTSW	9	20774012	critical splice donor site	probably null
R9562:Col5a3	UTSW	9	20803133	missense	unknown
R9781:Col5a3	UTSW	9	20809976	missense	unknown
Z1177:Col5a3	UTSW	9	20775334	missense	unknown

Predicted Primers

PCR Primer
(F):5'- GGGACCAATGAGGCCTATTAGC -3'
(R):5'- TCACCTGGTATCCTCAGCTG -3'

Sequencing Primer
(F):5'- TAGCCCAATGTGGCCCTGAAAG -3'
(R):5'- AAGCACATTTCCTGTCTCCTGACTG -3'

Posted On

2015-09-25