Incidental Mutation 'R4598:Col5a3'
ID345363
Institutional Source Beutler Lab
Gene Symbol Col5a3
Ensembl Gene ENSMUSG00000004098
Gene Namecollagen, type V, alpha 3
SynonymsPro-alpha3(V)
MMRRC Submission 041814-MU
Accession Numbers

Ncbi RefSeq: NM_016919.2; MGI:1858212

Is this an essential gene? Probably non essential (E-score: 0.200) question?
Stock #R4598 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location20770050-20815067 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 20774559 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000004201 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004201]
Predicted Effect probably null
Transcript: ENSMUST00000004201
SMART Domains Protein: ENSMUSP00000004201
Gene: ENSMUSG00000004098

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
TSPN 32 211 7.08e-28 SMART
LamG 89 210 2.13e-2 SMART
low complexity region 247 267 N/A INTRINSIC
low complexity region 295 314 N/A INTRINSIC
low complexity region 341 347 N/A INTRINSIC
low complexity region 369 381 N/A INTRINSIC
low complexity region 391 434 N/A INTRINSIC
low complexity region 461 474 N/A INTRINSIC
Pfam:Collagen 475 538 5.5e-10 PFAM
low complexity region 597 616 N/A INTRINSIC
low complexity region 628 694 N/A INTRINSIC
internal_repeat_3 703 737 7.13e-16 PROSPERO
low complexity region 742 821 N/A INTRINSIC
low complexity region 823 844 N/A INTRINSIC
low complexity region 859 889 N/A INTRINSIC
internal_repeat_2 892 1081 5.05e-17 PROSPERO
internal_repeat_1 996 1133 7.47e-22 PROSPERO
internal_repeat_3 1105 1139 7.13e-16 PROSPERO
low complexity region 1140 1165 N/A INTRINSIC
low complexity region 1168 1255 N/A INTRINSIC
low complexity region 1258 1282 N/A INTRINSIC
low complexity region 1285 1306 N/A INTRINSIC
low complexity region 1311 1418 N/A INTRINSIC
Pfam:Collagen 1429 1491 9.5e-10 PFAM
COLFI 1508 1738 7.98e-92 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype Strain: 5000519
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an alpha chain for one of the low abundance fibrillar collagens. Fibrillar collagen molecules are trimers that can be composed of one or more types of alpha chains. Type V collagen is found in tissues containing type I collagen and appears to regulate the assembly of heterotypic fibers composed of both type I and type V collagen. This gene product is closely related to type XI collagen and it is possible that the collagen chains of types V and XI constitute a single collagen type with tissue-specific chain combinations. Mutations in this gene are thought to be responsible for the symptoms of a subset of patients with Ehlers-Danlos syndrome type III. Messages of several sizes can be detected in northern blots but sequence information cannot confirm the identity of the shorter messages. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation show decreased pancreatic beta cell mass, hyperglycemia, hypoinsulinemia, impaired glucose tolerance, insulin resistance and impaired glucose uptake. Homozygous females show decreased susceptibility to diet-induced obesity and a thin hypodermal fat layer. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted(3)

Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830018L16Rik G A 1: 11,747,964 probably null Het
Abca14 T C 7: 120,255,403 V930A probably benign Het
Abcb7 A C X: 104,323,382 D135E probably benign Het
Ace T A 11: 105,981,759 probably null Het
Acnat1 T C 4: 49,450,781 D110G probably benign Het
Ak9 C T 10: 41,383,911 P862S probably damaging Het
Atp1a3 A G 7: 24,979,341 S972P probably damaging Het
Bmf C A 2: 118,549,128 A56S probably benign Het
C6 T C 15: 4,763,370 L319P possibly damaging Het
Cab39 A G 1: 85,848,329 Y249C probably damaging Het
Cdc14b T C 13: 64,247,274 T69A probably benign Het
Cep162 A G 9: 87,203,795 Y1159H possibly damaging Het
Chrna7 A G 7: 63,103,790 M327T probably damaging Het
Clca3a2 A T 3: 144,805,683 N41K probably damaging Het
Clock T C 5: 76,235,810 M499V probably benign Het
Coq6 T C 12: 84,362,139 V30A probably benign Het
Cyp3a57 A G 5: 145,390,417 I473V probably benign Het
D430041D05Rik A T 2: 104,208,183 V1547D probably damaging Het
Dhx9 TCC TC 1: 153,467,051 probably null Het
Dock2 T A 11: 34,239,536 Y1545F probably damaging Het
Eif4e3 T A 6: 99,640,710 I67L probably benign Het
Epor A G 9: 21,961,859 S86P probably benign Het
Esp31 T A 17: 38,641,121 probably null Het
Esrp2 A G 8: 106,132,711 M498T probably damaging Het
F5 T C 1: 164,204,797 I1771T probably benign Het
Fancd2 C A 6: 113,585,477 H1259Q probably benign Het
Gale C A 4: 135,967,837 S341* probably null Het
Ints12 T A 3: 133,098,453 I67N probably benign Het
Kat2b A G 17: 53,670,798 Y791C probably benign Het
Kazn A G 4: 142,210,092 V108A possibly damaging Het
Kcnma1 T C 14: 23,803,160 T109A probably damaging Het
Med13 T C 11: 86,278,566 T1955A probably damaging Het
Megf10 G A 18: 57,189,603 probably null Het
Megf10 A T 18: 57,287,812 S841C probably damaging Het
Mep1a A G 17: 43,491,578 probably null Het
Mrap2 A T 9: 87,182,789 E194D probably damaging Het
Msh2 A G 17: 87,708,578 K546R probably damaging Het
Ndc80 T C 17: 71,521,068 D88G probably damaging Het
Nrip1 A G 16: 76,293,080 F530L probably damaging Het
Olfr1380 T C 11: 49,564,718 S266P probably damaging Het
Olfr1504 A T 19: 13,888,017 H64Q probably damaging Het
Olfr676 A C 7: 105,036,073 I292L probably benign Het
Olfr812 T C 10: 129,842,995 T16A possibly damaging Het
Oxtr C T 6: 112,489,752 G16R probably benign Het
Pdgfrb A T 18: 61,068,757 K464N probably benign Het
Pja2 A T 17: 64,313,030 M1K probably null Het
Pkhd1 A T 1: 20,503,056 N1875K probably damaging Het
Pogz T C 3: 94,880,180 S1360P possibly damaging Het
Proc A T 18: 32,123,459 L385Q probably damaging Het
Ptprm A G 17: 67,095,497 I132T probably benign Het
Rpgr A G X: 10,196,016 S343P probably benign Het
Rsu1 T C 2: 13,170,004 Y225C probably damaging Het
Scyl1 A G 19: 5,770,453 S118P probably damaging Het
Sec61a1 T C 6: 88,506,149 N414D probably benign Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Sema7a A G 9: 57,953,551 D65G probably benign Het
Slc25a45 A G 19: 5,884,436 Y144C probably damaging Het
Slc26a6 A G 9: 108,856,380 Y103C probably damaging Het
Stat3 C T 11: 100,903,674 D270N probably damaging Het
Taar8b T C 10: 24,091,838 S153G probably benign Het
Top1 A G 2: 160,720,965 E697G possibly damaging Het
Trappc11 G A 8: 47,513,766 T470I probably damaging Het
Ttc7b G A 12: 100,500,117 R79C probably damaging Het
Usp29 A G 7: 6,962,480 T441A probably benign Het
Vmn2r110 A T 17: 20,583,767 L182* probably null Het
Zgrf1 T C 3: 127,601,030 I1345T probably benign Het
Zscan25 G T 5: 145,291,005 R493L probably benign Het
Other mutations in Col5a3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00834:Col5a3 APN 9 20786389 nonsense probably null
IGL01548:Col5a3 APN 9 20803000 splice site probably benign
IGL02164:Col5a3 APN 9 20792643 critical splice donor site probably null
IGL02297:Col5a3 APN 9 20772154 missense unknown
IGL02333:Col5a3 APN 9 20799306 missense unknown
IGL02349:Col5a3 APN 9 20772361 missense unknown
IGL02390:Col5a3 APN 9 20776996 missense unknown
IGL02685:Col5a3 APN 9 20772205 missense unknown
IGL02941:Col5a3 APN 9 20804666 missense unknown
IGL03001:Col5a3 APN 9 20807744 missense unknown
IGL03061:Col5a3 APN 9 20797572 critical splice donor site probably null
IGL03102:Col5a3 APN 9 20804635 critical splice donor site probably null
IGL03308:Col5a3 APN 9 20808379 missense unknown
IGL03372:Col5a3 APN 9 20775328 missense unknown
R0002:Col5a3 UTSW 9 20809856 critical splice acceptor site probably null
R0012:Col5a3 UTSW 9 20777108 splice site probably benign
R0316:Col5a3 UTSW 9 20775325 missense unknown
R0357:Col5a3 UTSW 9 20807768 splice site probably benign
R0360:Col5a3 UTSW 9 20772466 missense unknown
R0483:Col5a3 UTSW 9 20782481 splice site probably null
R0485:Col5a3 UTSW 9 20782708 missense probably damaging 0.99
R0627:Col5a3 UTSW 9 20775485 missense unknown
R1035:Col5a3 UTSW 9 20793499 splice site probably benign
R1051:Col5a3 UTSW 9 20775235 missense unknown
R1295:Col5a3 UTSW 9 20808418 missense unknown
R1438:Col5a3 UTSW 9 20779957 missense probably damaging 0.99
R1622:Col5a3 UTSW 9 20772220 missense unknown
R1668:Col5a3 UTSW 9 20771096 missense unknown
R1680:Col5a3 UTSW 9 20784668 critical splice donor site probably null
R2112:Col5a3 UTSW 9 20809777 missense unknown
R2149:Col5a3 UTSW 9 20771270 missense unknown
R2159:Col5a3 UTSW 9 20771310 missense unknown
R2939:Col5a3 UTSW 9 20795658 missense unknown
R3236:Col5a3 UTSW 9 20807653 missense unknown
R3845:Col5a3 UTSW 9 20808377 missense unknown
R4599:Col5a3 UTSW 9 20774559 critical splice donor site probably null
R4611:Col5a3 UTSW 9 20814896 unclassified probably benign
R4713:Col5a3 UTSW 9 20793574 missense unknown
R4723:Col5a3 UTSW 9 20809591 missense unknown
R5209:Col5a3 UTSW 9 20778643 intron probably benign
R5336:Col5a3 UTSW 9 20799301 missense unknown
R5378:Col5a3 UTSW 9 20797576 missense unknown
R5614:Col5a3 UTSW 9 20783476 splice site probably benign
R5775:Col5a3 UTSW 9 20801072 missense unknown
R5895:Col5a3 UTSW 9 20772442 missense unknown
R6048:Col5a3 UTSW 9 20807619 missense unknown
R6265:Col5a3 UTSW 9 20793764 missense unknown
R6372:Col5a3 UTSW 9 20785586 missense probably damaging 0.99
R6520:Col5a3 UTSW 9 20774052 missense unknown
R6558:Col5a3 UTSW 9 20779033 missense probably damaging 1.00
R6608:Col5a3 UTSW 9 20774019 missense unknown
R6679:Col5a3 UTSW 9 20779033 missense probably damaging 1.00
R6680:Col5a3 UTSW 9 20779033 missense probably damaging 1.00
R6696:Col5a3 UTSW 9 20779033 missense probably damaging 1.00
R6698:Col5a3 UTSW 9 20779033 missense probably damaging 1.00
R6700:Col5a3 UTSW 9 20779033 missense probably damaging 1.00
R6708:Col5a3 UTSW 9 20775035 missense unknown
R6712:Col5a3 UTSW 9 20779033 missense probably damaging 1.00
R6714:Col5a3 UTSW 9 20779033 missense probably damaging 1.00
R6828:Col5a3 UTSW 9 20798452 missense unknown
R7343:Col5a3 UTSW 9 20793946 critical splice donor site probably null
R7431:Col5a3 UTSW 9 20770835 makesense probably null
R7500:Col5a3 UTSW 9 20800289 missense unknown
R7592:Col5a3 UTSW 9 20797393 missense unknown
R7671:Col5a3 UTSW 9 20775086 critical splice acceptor site probably null
Z1177:Col5a3 UTSW 9 20775334 missense unknown
Predicted Primers PCR Primer
(F):5'- GGGACCAATGAGGCCTATTAGC -3'
(R):5'- TCACCTGGTATCCTCAGCTG -3'

Sequencing Primer
(F):5'- TAGCCCAATGTGGCCCTGAAAG -3'
(R):5'- AAGCACATTTCCTGTCTCCTGACTG -3'
Posted On2015-09-25