Incidental Mutation 'R4598:Col5a3'
ID 345363
Institutional Source Beutler Lab
Gene Symbol Col5a3
Ensembl Gene ENSMUSG00000004098
Gene Name collagen, type V, alpha 3
Synonyms Pro-alpha3(V)
MMRRC Submission 041814-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.398) question?
Stock # R4598 (G1)
Quality Score 225
Status Not validated
Chromosome 9
Chromosomal Location 20681353-20726363 bp(-) (GRCm39)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 20685855 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000004201 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004201]
AlphaFold Q9JLI2
Predicted Effect probably null
Transcript: ENSMUST00000004201
SMART Domains Protein: ENSMUSP00000004201
Gene: ENSMUSG00000004098

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
TSPN 32 211 7.08e-28 SMART
LamG 89 210 2.13e-2 SMART
low complexity region 247 267 N/A INTRINSIC
low complexity region 295 314 N/A INTRINSIC
low complexity region 341 347 N/A INTRINSIC
low complexity region 369 381 N/A INTRINSIC
low complexity region 391 434 N/A INTRINSIC
low complexity region 461 474 N/A INTRINSIC
Pfam:Collagen 475 538 5.5e-10 PFAM
low complexity region 597 616 N/A INTRINSIC
low complexity region 628 694 N/A INTRINSIC
internal_repeat_3 703 737 7.13e-16 PROSPERO
low complexity region 742 821 N/A INTRINSIC
low complexity region 823 844 N/A INTRINSIC
low complexity region 859 889 N/A INTRINSIC
internal_repeat_2 892 1081 5.05e-17 PROSPERO
internal_repeat_1 996 1133 7.47e-22 PROSPERO
internal_repeat_3 1105 1139 7.13e-16 PROSPERO
low complexity region 1140 1165 N/A INTRINSIC
low complexity region 1168 1255 N/A INTRINSIC
low complexity region 1258 1282 N/A INTRINSIC
low complexity region 1285 1306 N/A INTRINSIC
low complexity region 1311 1418 N/A INTRINSIC
Pfam:Collagen 1429 1491 9.5e-10 PFAM
COLFI 1508 1738 7.98e-92 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an alpha chain for one of the low abundance fibrillar collagens. Fibrillar collagen molecules are trimers that can be composed of one or more types of alpha chains. Type V collagen is found in tissues containing type I collagen and appears to regulate the assembly of heterotypic fibers composed of both type I and type V collagen. This gene product is closely related to type XI collagen and it is possible that the collagen chains of types V and XI constitute a single collagen type with tissue-specific chain combinations. Mutations in this gene are thought to be responsible for the symptoms of a subset of patients with Ehlers-Danlos syndrome type III. Messages of several sizes can be detected in northern blots but sequence information cannot confirm the identity of the shorter messages. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation show decreased pancreatic beta cell mass, hyperglycemia, hypoinsulinemia, impaired glucose tolerance, insulin resistance and impaired glucose uptake. Homozygous females show decreased susceptibility to diet-induced obesity and a thin hypodermal fat layer. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted(3)

Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830018L16Rik G A 1: 11,818,188 (GRCm39) probably null Het
Abca14 T C 7: 119,854,626 (GRCm39) V930A probably benign Het
Abcb7 A C X: 103,366,988 (GRCm39) D135E probably benign Het
Ace T A 11: 105,872,585 (GRCm39) probably null Het
Acnat1 T C 4: 49,450,781 (GRCm39) D110G probably benign Het
Ak9 C T 10: 41,259,907 (GRCm39) P862S probably damaging Het
Atp1a3 A G 7: 24,678,766 (GRCm39) S972P probably damaging Het
Bmf C A 2: 118,379,609 (GRCm39) A56S probably benign Het
C6 T C 15: 4,792,852 (GRCm39) L319P possibly damaging Het
Cab39 A G 1: 85,776,050 (GRCm39) Y249C probably damaging Het
Cdc14b T C 13: 64,395,088 (GRCm39) T69A probably benign Het
Cep162 A G 9: 87,085,848 (GRCm39) Y1159H possibly damaging Het
Chrna7 A G 7: 62,753,538 (GRCm39) M327T probably damaging Het
Clca3a2 A T 3: 144,511,444 (GRCm39) N41K probably damaging Het
Clock T C 5: 76,383,657 (GRCm39) M499V probably benign Het
Coq6 T C 12: 84,408,913 (GRCm39) V30A probably benign Het
Cyp3a57 A G 5: 145,327,227 (GRCm39) I473V probably benign Het
D430041D05Rik A T 2: 104,038,528 (GRCm39) V1547D probably damaging Het
Dhx9 TCC TC 1: 153,342,797 (GRCm39) probably null Het
Dock2 T A 11: 34,189,536 (GRCm39) Y1545F probably damaging Het
Eif4e3 T A 6: 99,617,671 (GRCm39) I67L probably benign Het
Epor A G 9: 21,873,155 (GRCm39) S86P probably benign Het
Esp31 T A 17: 38,952,012 (GRCm39) probably null Het
Esrp2 A G 8: 106,859,343 (GRCm39) M498T probably damaging Het
F5 T C 1: 164,032,366 (GRCm39) I1771T probably benign Het
Fancd2 C A 6: 113,562,438 (GRCm39) H1259Q probably benign Het
Gale C A 4: 135,695,148 (GRCm39) S341* probably null Het
Ints12 T A 3: 132,804,214 (GRCm39) I67N probably benign Het
Kat2b A G 17: 53,977,826 (GRCm39) Y791C probably benign Het
Kazn A G 4: 141,937,403 (GRCm39) V108A possibly damaging Het
Kcnma1 T C 14: 23,853,228 (GRCm39) T109A probably damaging Het
Med13 T C 11: 86,169,392 (GRCm39) T1955A probably damaging Het
Megf10 A T 18: 57,420,884 (GRCm39) S841C probably damaging Het
Megf10 G A 18: 57,322,675 (GRCm39) probably null Het
Mep1a A G 17: 43,802,469 (GRCm39) probably null Het
Mrap2 A T 9: 87,064,842 (GRCm39) E194D probably damaging Het
Msh2 A G 17: 88,016,006 (GRCm39) K546R probably damaging Het
Ndc80 T C 17: 71,828,063 (GRCm39) D88G probably damaging Het
Nrip1 A G 16: 76,089,968 (GRCm39) F530L probably damaging Het
Or2y10 T C 11: 49,455,545 (GRCm39) S266P probably damaging Het
Or52e7 A C 7: 104,685,280 (GRCm39) I292L probably benign Het
Or6c216 T C 10: 129,678,864 (GRCm39) T16A possibly damaging Het
Or9i16 A T 19: 13,865,381 (GRCm39) H64Q probably damaging Het
Oxtr C T 6: 112,466,713 (GRCm39) G16R probably benign Het
Pdgfrb A T 18: 61,201,829 (GRCm39) K464N probably benign Het
Pja2 A T 17: 64,620,025 (GRCm39) M1K probably null Het
Pkhd1 A T 1: 20,573,280 (GRCm39) N1875K probably damaging Het
Pogz T C 3: 94,787,491 (GRCm39) S1360P possibly damaging Het
Proc A T 18: 32,256,512 (GRCm39) L385Q probably damaging Het
Ptprm A G 17: 67,402,492 (GRCm39) I132T probably benign Het
Rpgr A G X: 10,062,255 (GRCm39) S343P probably benign Het
Rsu1 T C 2: 13,174,815 (GRCm39) Y225C probably damaging Het
Scyl1 A G 19: 5,820,481 (GRCm39) S118P probably damaging Het
Sec61a1 T C 6: 88,483,131 (GRCm39) N414D probably benign Het
Secisbp2l C T 2: 125,582,657 (GRCm39) G933D possibly damaging Het
Sema7a A G 9: 57,860,834 (GRCm39) D65G probably benign Het
Slc25a45 A G 19: 5,934,464 (GRCm39) Y144C probably damaging Het
Slc26a6 A G 9: 108,733,579 (GRCm39) Y103C probably damaging Het
Stat3 C T 11: 100,794,500 (GRCm39) D270N probably damaging Het
Taar8b T C 10: 23,967,736 (GRCm39) S153G probably benign Het
Top1 A G 2: 160,562,885 (GRCm39) E697G possibly damaging Het
Trappc11 G A 8: 47,966,801 (GRCm39) T470I probably damaging Het
Ttc7b G A 12: 100,466,376 (GRCm39) R79C probably damaging Het
Usp29 A G 7: 6,965,479 (GRCm39) T441A probably benign Het
Vmn2r110 A T 17: 20,804,029 (GRCm39) L182* probably null Het
Zgrf1 T C 3: 127,394,679 (GRCm39) I1345T probably benign Het
Zscan25 G T 5: 145,227,815 (GRCm39) R493L probably benign Het
Other mutations in Col5a3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00834:Col5a3 APN 9 20,697,685 (GRCm39) nonsense probably null
IGL01548:Col5a3 APN 9 20,714,296 (GRCm39) splice site probably benign
IGL02164:Col5a3 APN 9 20,703,939 (GRCm39) critical splice donor site probably null
IGL02297:Col5a3 APN 9 20,683,450 (GRCm39) missense unknown
IGL02333:Col5a3 APN 9 20,710,602 (GRCm39) missense unknown
IGL02349:Col5a3 APN 9 20,683,657 (GRCm39) missense unknown
IGL02390:Col5a3 APN 9 20,688,292 (GRCm39) missense unknown
IGL02685:Col5a3 APN 9 20,683,501 (GRCm39) missense unknown
IGL02941:Col5a3 APN 9 20,715,962 (GRCm39) missense unknown
IGL03001:Col5a3 APN 9 20,719,040 (GRCm39) missense unknown
IGL03061:Col5a3 APN 9 20,708,868 (GRCm39) critical splice donor site probably null
IGL03102:Col5a3 APN 9 20,715,931 (GRCm39) critical splice donor site probably null
IGL03308:Col5a3 APN 9 20,719,675 (GRCm39) missense unknown
IGL03372:Col5a3 APN 9 20,686,624 (GRCm39) missense unknown
Guppy UTSW 9 20,690,329 (GRCm39) missense probably damaging 1.00
minifish UTSW 9 20,696,882 (GRCm39) missense probably damaging 0.99
R0002:Col5a3 UTSW 9 20,721,152 (GRCm39) critical splice acceptor site probably null
R0012:Col5a3 UTSW 9 20,688,404 (GRCm39) splice site probably benign
R0316:Col5a3 UTSW 9 20,686,621 (GRCm39) missense unknown
R0357:Col5a3 UTSW 9 20,719,064 (GRCm39) splice site probably benign
R0360:Col5a3 UTSW 9 20,683,762 (GRCm39) missense unknown
R0483:Col5a3 UTSW 9 20,693,777 (GRCm39) splice site probably null
R0485:Col5a3 UTSW 9 20,694,004 (GRCm39) missense probably damaging 0.99
R0627:Col5a3 UTSW 9 20,686,781 (GRCm39) missense unknown
R1035:Col5a3 UTSW 9 20,704,795 (GRCm39) splice site probably benign
R1051:Col5a3 UTSW 9 20,686,531 (GRCm39) missense unknown
R1295:Col5a3 UTSW 9 20,719,714 (GRCm39) missense unknown
R1438:Col5a3 UTSW 9 20,691,253 (GRCm39) missense probably damaging 0.99
R1622:Col5a3 UTSW 9 20,683,516 (GRCm39) missense unknown
R1668:Col5a3 UTSW 9 20,682,392 (GRCm39) missense unknown
R1680:Col5a3 UTSW 9 20,695,964 (GRCm39) critical splice donor site probably null
R2112:Col5a3 UTSW 9 20,721,073 (GRCm39) missense unknown
R2149:Col5a3 UTSW 9 20,682,566 (GRCm39) missense unknown
R2159:Col5a3 UTSW 9 20,682,606 (GRCm39) missense unknown
R2939:Col5a3 UTSW 9 20,706,954 (GRCm39) missense unknown
R3236:Col5a3 UTSW 9 20,718,949 (GRCm39) missense unknown
R3845:Col5a3 UTSW 9 20,719,673 (GRCm39) missense unknown
R4599:Col5a3 UTSW 9 20,685,855 (GRCm39) critical splice donor site probably null
R4611:Col5a3 UTSW 9 20,726,192 (GRCm39) unclassified probably benign
R4713:Col5a3 UTSW 9 20,704,870 (GRCm39) missense unknown
R4723:Col5a3 UTSW 9 20,720,887 (GRCm39) missense unknown
R5209:Col5a3 UTSW 9 20,689,939 (GRCm39) intron probably benign
R5336:Col5a3 UTSW 9 20,710,597 (GRCm39) missense unknown
R5378:Col5a3 UTSW 9 20,708,872 (GRCm39) missense unknown
R5614:Col5a3 UTSW 9 20,694,772 (GRCm39) splice site probably benign
R5775:Col5a3 UTSW 9 20,712,368 (GRCm39) missense unknown
R5895:Col5a3 UTSW 9 20,683,738 (GRCm39) missense unknown
R6048:Col5a3 UTSW 9 20,718,915 (GRCm39) missense unknown
R6265:Col5a3 UTSW 9 20,705,060 (GRCm39) missense unknown
R6372:Col5a3 UTSW 9 20,696,882 (GRCm39) missense probably damaging 0.99
R6520:Col5a3 UTSW 9 20,685,348 (GRCm39) missense unknown
R6558:Col5a3 UTSW 9 20,690,329 (GRCm39) missense probably damaging 1.00
R6608:Col5a3 UTSW 9 20,685,315 (GRCm39) missense unknown
R6679:Col5a3 UTSW 9 20,690,329 (GRCm39) missense probably damaging 1.00
R6680:Col5a3 UTSW 9 20,690,329 (GRCm39) missense probably damaging 1.00
R6696:Col5a3 UTSW 9 20,690,329 (GRCm39) missense probably damaging 1.00
R6698:Col5a3 UTSW 9 20,690,329 (GRCm39) missense probably damaging 1.00
R6700:Col5a3 UTSW 9 20,690,329 (GRCm39) missense probably damaging 1.00
R6708:Col5a3 UTSW 9 20,686,331 (GRCm39) missense unknown
R6712:Col5a3 UTSW 9 20,690,329 (GRCm39) missense probably damaging 1.00
R6714:Col5a3 UTSW 9 20,690,329 (GRCm39) missense probably damaging 1.00
R6828:Col5a3 UTSW 9 20,709,748 (GRCm39) missense unknown
R7343:Col5a3 UTSW 9 20,705,242 (GRCm39) critical splice donor site probably null
R7431:Col5a3 UTSW 9 20,682,131 (GRCm39) makesense probably null
R7500:Col5a3 UTSW 9 20,711,585 (GRCm39) missense unknown
R7592:Col5a3 UTSW 9 20,708,689 (GRCm39) missense unknown
R7671:Col5a3 UTSW 9 20,686,382 (GRCm39) critical splice acceptor site probably null
R7957:Col5a3 UTSW 9 20,685,347 (GRCm39) missense unknown
R8510:Col5a3 UTSW 9 20,705,028 (GRCm39) missense unknown
R8979:Col5a3 UTSW 9 20,686,597 (GRCm39) missense unknown
R9050:Col5a3 UTSW 9 20,697,691 (GRCm39) missense probably damaging 1.00
R9052:Col5a3 UTSW 9 20,710,733 (GRCm39) missense unknown
R9072:Col5a3 UTSW 9 20,682,453 (GRCm39) missense unknown
R9341:Col5a3 UTSW 9 20,704,909 (GRCm39) missense unknown
R9343:Col5a3 UTSW 9 20,704,909 (GRCm39) missense unknown
R9529:Col5a3 UTSW 9 20,685,308 (GRCm39) critical splice donor site probably null
R9562:Col5a3 UTSW 9 20,714,429 (GRCm39) missense unknown
R9781:Col5a3 UTSW 9 20,721,272 (GRCm39) missense unknown
Z1177:Col5a3 UTSW 9 20,686,630 (GRCm39) missense unknown
Predicted Primers PCR Primer
(F):5'- GGGACCAATGAGGCCTATTAGC -3'
(R):5'- TCACCTGGTATCCTCAGCTG -3'

Sequencing Primer
(F):5'- TAGCCCAATGTGGCCCTGAAAG -3'
(R):5'- AAGCACATTTCCTGTCTCCTGACTG -3'
Posted On 2015-09-25