Incidental Mutation 'R4598:Sema7a'
ID345365
Institutional Source Beutler Lab
Gene Symbol Sema7a
Ensembl Gene ENSMUSG00000038264
Gene Namesema domain, immunoglobulin domain (Ig), and GPI membrane anchor, (semaphorin) 7A
SynonymsCDw108, Semal, 2900057C09Rik, Semaphorin K1
MMRRC Submission 041814-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.265) question?
Stock #R4598 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location57940112-57962865 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 57953551 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 65 (D65G)
Ref Sequence ENSEMBL: ENSMUSP00000042211 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043059] [ENSMUST00000214314]
Predicted Effect probably benign
Transcript: ENSMUST00000043059
AA Change: D65G

PolyPhen 2 Score 0.044 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000042211
Gene: ENSMUSG00000038264
AA Change: D65G

DomainStartEndE-ValueType
signal peptide 1 44 N/A INTRINSIC
Sema 72 472 4.11e-119 SMART
PSI 490 540 7.64e-9 SMART
IG 549 630 3.63e-1 SMART
transmembrane domain 644 663 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000214314
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the semaphorin family of proteins. The encoded preproprotein is proteolytically processed to generate the mature glycosylphosphatidylinositol (GPI)-anchored membrane glycoprotein. The encoded protein is found on activated lymphocytes and erythrocytes and may be involved in immunomodulatory and neuronal processes. The encoded protein carries the John Milton Hagen (JMH) blood group antigens. Mutations in this gene may be associated with reduced bone mineral density (BMD). Alternative splicing results in multiple transcript variants, at least one of which encodes an isoform that is proteolytically processed. [provided by RefSeq, Feb 2016]
PHENOTYPE: The development of the olfactory tract is impaired in homozygous null mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830018L16Rik G A 1: 11,747,964 probably null Het
Abca14 T C 7: 120,255,403 V930A probably benign Het
Abcb7 A C X: 104,323,382 D135E probably benign Het
Ace T A 11: 105,981,759 probably null Het
Acnat1 T C 4: 49,450,781 D110G probably benign Het
Ak9 C T 10: 41,383,911 P862S probably damaging Het
Atp1a3 A G 7: 24,979,341 S972P probably damaging Het
Bmf C A 2: 118,549,128 A56S probably benign Het
C6 T C 15: 4,763,370 L319P possibly damaging Het
Cab39 A G 1: 85,848,329 Y249C probably damaging Het
Cdc14b T C 13: 64,247,274 T69A probably benign Het
Cep162 A G 9: 87,203,795 Y1159H possibly damaging Het
Chrna7 A G 7: 63,103,790 M327T probably damaging Het
Clca3a2 A T 3: 144,805,683 N41K probably damaging Het
Clock T C 5: 76,235,810 M499V probably benign Het
Col5a3 A G 9: 20,774,559 probably null Het
Coq6 T C 12: 84,362,139 V30A probably benign Het
Cyp3a57 A G 5: 145,390,417 I473V probably benign Het
D430041D05Rik A T 2: 104,208,183 V1547D probably damaging Het
Dhx9 TCC TC 1: 153,467,051 probably null Het
Dock2 T A 11: 34,239,536 Y1545F probably damaging Het
Eif4e3 T A 6: 99,640,710 I67L probably benign Het
Epor A G 9: 21,961,859 S86P probably benign Het
Esp31 T A 17: 38,641,121 probably null Het
Esrp2 A G 8: 106,132,711 M498T probably damaging Het
F5 T C 1: 164,204,797 I1771T probably benign Het
Fancd2 C A 6: 113,585,477 H1259Q probably benign Het
Gale C A 4: 135,967,837 S341* probably null Het
Ints12 T A 3: 133,098,453 I67N probably benign Het
Kat2b A G 17: 53,670,798 Y791C probably benign Het
Kazn A G 4: 142,210,092 V108A possibly damaging Het
Kcnma1 T C 14: 23,803,160 T109A probably damaging Het
Med13 T C 11: 86,278,566 T1955A probably damaging Het
Megf10 G A 18: 57,189,603 probably null Het
Megf10 A T 18: 57,287,812 S841C probably damaging Het
Mep1a A G 17: 43,491,578 probably null Het
Mrap2 A T 9: 87,182,789 E194D probably damaging Het
Msh2 A G 17: 87,708,578 K546R probably damaging Het
Ndc80 T C 17: 71,521,068 D88G probably damaging Het
Nrip1 A G 16: 76,293,080 F530L probably damaging Het
Olfr1380 T C 11: 49,564,718 S266P probably damaging Het
Olfr1504 A T 19: 13,888,017 H64Q probably damaging Het
Olfr676 A C 7: 105,036,073 I292L probably benign Het
Olfr812 T C 10: 129,842,995 T16A possibly damaging Het
Oxtr C T 6: 112,489,752 G16R probably benign Het
Pdgfrb A T 18: 61,068,757 K464N probably benign Het
Pja2 A T 17: 64,313,030 M1K probably null Het
Pkhd1 A T 1: 20,503,056 N1875K probably damaging Het
Pogz T C 3: 94,880,180 S1360P possibly damaging Het
Proc A T 18: 32,123,459 L385Q probably damaging Het
Ptprm A G 17: 67,095,497 I132T probably benign Het
Rpgr A G X: 10,196,016 S343P probably benign Het
Rsu1 T C 2: 13,170,004 Y225C probably damaging Het
Scyl1 A G 19: 5,770,453 S118P probably damaging Het
Sec61a1 T C 6: 88,506,149 N414D probably benign Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Slc25a45 A G 19: 5,884,436 Y144C probably damaging Het
Slc26a6 A G 9: 108,856,380 Y103C probably damaging Het
Stat3 C T 11: 100,903,674 D270N probably damaging Het
Taar8b T C 10: 24,091,838 S153G probably benign Het
Top1 A G 2: 160,720,965 E697G possibly damaging Het
Trappc11 G A 8: 47,513,766 T470I probably damaging Het
Ttc7b G A 12: 100,500,117 R79C probably damaging Het
Usp29 A G 7: 6,962,480 T441A probably benign Het
Vmn2r110 A T 17: 20,583,767 L182* probably null Het
Zgrf1 T C 3: 127,601,030 I1345T probably benign Het
Zscan25 G T 5: 145,291,005 R493L probably benign Het
Other mutations in Sema7a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00925:Sema7a APN 9 57955838 missense probably damaging 1.00
IGL01967:Sema7a APN 9 57956395 missense probably damaging 1.00
IGL02030:Sema7a APN 9 57955140 missense possibly damaging 0.91
IGL02031:Sema7a APN 9 57955140 missense possibly damaging 0.91
IGL02115:Sema7a APN 9 57960900 missense probably damaging 1.00
IGL02203:Sema7a APN 9 57957606 missense probably benign
IGL02808:Sema7a APN 9 57960348 missense probably benign 0.25
R0531:Sema7a UTSW 9 57960593 missense possibly damaging 0.95
R1603:Sema7a UTSW 9 57960676 missense probably benign 0.18
R1845:Sema7a UTSW 9 57954899 missense possibly damaging 0.65
R4903:Sema7a UTSW 9 57955095 missense probably benign 0.00
R4954:Sema7a UTSW 9 57956380 missense probably damaging 1.00
R5172:Sema7a UTSW 9 57957678 missense probably benign 0.02
R5514:Sema7a UTSW 9 57955763 missense probably damaging 1.00
R5618:Sema7a UTSW 9 57960283 missense possibly damaging 0.71
R5652:Sema7a UTSW 9 57960659 missense probably damaging 1.00
R5793:Sema7a UTSW 9 57960257 missense probably damaging 0.98
R6365:Sema7a UTSW 9 57954905 missense probably benign 0.31
R6736:Sema7a UTSW 9 57960571 missense probably damaging 1.00
R6822:Sema7a UTSW 9 57960336 missense probably damaging 1.00
R6829:Sema7a UTSW 9 57960898 missense probably benign 0.00
R7380:Sema7a UTSW 9 57961564 missense unknown
R7381:Sema7a UTSW 9 57953569 missense probably benign 0.00
R7467:Sema7a UTSW 9 57961422 missense probably damaging 1.00
R7593:Sema7a UTSW 9 57960575 missense probably benign 0.06
R7601:Sema7a UTSW 9 57940277 missense probably benign 0.14
R7879:Sema7a UTSW 9 57955080 missense probably damaging 1.00
R7962:Sema7a UTSW 9 57955080 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGGCATTCCTTACTTCTCAGG -3'
(R):5'- GAAAGATGTGCCAGCTCCTTC -3'

Sequencing Primer
(F):5'- TTCTCAGGTCCACCTACACCAG -3'
(R):5'- CGTAAGGGCCGTCAGTAGGAC -3'
Posted On2015-09-25