Incidental Mutation 'R4598:Cep162'
ID 345367
Institutional Source Beutler Lab
Gene Symbol Cep162
Ensembl Gene ENSMUSG00000056919
Gene Name centrosomal protein 162
Synonyms 4922501C03Rik
MMRRC Submission 041814-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.093) question?
Stock # R4598 (G1)
Quality Score 225
Status Not validated
Chromosome 9
Chromosomal Location 87071630-87137589 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 87085848 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Histidine at position 1159 (Y1159H)
Ref Sequence ENSEMBL: ENSMUSP00000091319 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093802]
AlphaFold Q6ZQ06
Predicted Effect possibly damaging
Transcript: ENSMUST00000093802
AA Change: Y1159H

PolyPhen 2 Score 0.949 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000091319
Gene: ENSMUSG00000056919
AA Change: Y1159H

DomainStartEndE-ValueType
low complexity region 198 208 N/A INTRINSIC
low complexity region 528 539 N/A INTRINSIC
coiled coil region 630 674 N/A INTRINSIC
coiled coil region 695 899 N/A INTRINSIC
coiled coil region 953 1124 N/A INTRINSIC
coiled coil region 1235 1386 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139301
Predicted Effect noncoding transcript
Transcript: ENSMUST00000157106
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830018L16Rik G A 1: 11,818,188 (GRCm39) probably null Het
Abca14 T C 7: 119,854,626 (GRCm39) V930A probably benign Het
Abcb7 A C X: 103,366,988 (GRCm39) D135E probably benign Het
Ace T A 11: 105,872,585 (GRCm39) probably null Het
Acnat1 T C 4: 49,450,781 (GRCm39) D110G probably benign Het
Ak9 C T 10: 41,259,907 (GRCm39) P862S probably damaging Het
Atp1a3 A G 7: 24,678,766 (GRCm39) S972P probably damaging Het
Bmf C A 2: 118,379,609 (GRCm39) A56S probably benign Het
C6 T C 15: 4,792,852 (GRCm39) L319P possibly damaging Het
Cab39 A G 1: 85,776,050 (GRCm39) Y249C probably damaging Het
Cdc14b T C 13: 64,395,088 (GRCm39) T69A probably benign Het
Chrna7 A G 7: 62,753,538 (GRCm39) M327T probably damaging Het
Clca3a2 A T 3: 144,511,444 (GRCm39) N41K probably damaging Het
Clock T C 5: 76,383,657 (GRCm39) M499V probably benign Het
Col5a3 A G 9: 20,685,855 (GRCm39) probably null Het
Coq6 T C 12: 84,408,913 (GRCm39) V30A probably benign Het
Cyp3a57 A G 5: 145,327,227 (GRCm39) I473V probably benign Het
D430041D05Rik A T 2: 104,038,528 (GRCm39) V1547D probably damaging Het
Dhx9 TCC TC 1: 153,342,797 (GRCm39) probably null Het
Dock2 T A 11: 34,189,536 (GRCm39) Y1545F probably damaging Het
Eif4e3 T A 6: 99,617,671 (GRCm39) I67L probably benign Het
Epor A G 9: 21,873,155 (GRCm39) S86P probably benign Het
Esp31 T A 17: 38,952,012 (GRCm39) probably null Het
Esrp2 A G 8: 106,859,343 (GRCm39) M498T probably damaging Het
F5 T C 1: 164,032,366 (GRCm39) I1771T probably benign Het
Fancd2 C A 6: 113,562,438 (GRCm39) H1259Q probably benign Het
Gale C A 4: 135,695,148 (GRCm39) S341* probably null Het
Ints12 T A 3: 132,804,214 (GRCm39) I67N probably benign Het
Kat2b A G 17: 53,977,826 (GRCm39) Y791C probably benign Het
Kazn A G 4: 141,937,403 (GRCm39) V108A possibly damaging Het
Kcnma1 T C 14: 23,853,228 (GRCm39) T109A probably damaging Het
Med13 T C 11: 86,169,392 (GRCm39) T1955A probably damaging Het
Megf10 A T 18: 57,420,884 (GRCm39) S841C probably damaging Het
Megf10 G A 18: 57,322,675 (GRCm39) probably null Het
Mep1a A G 17: 43,802,469 (GRCm39) probably null Het
Mrap2 A T 9: 87,064,842 (GRCm39) E194D probably damaging Het
Msh2 A G 17: 88,016,006 (GRCm39) K546R probably damaging Het
Ndc80 T C 17: 71,828,063 (GRCm39) D88G probably damaging Het
Nrip1 A G 16: 76,089,968 (GRCm39) F530L probably damaging Het
Or2y10 T C 11: 49,455,545 (GRCm39) S266P probably damaging Het
Or52e7 A C 7: 104,685,280 (GRCm39) I292L probably benign Het
Or6c216 T C 10: 129,678,864 (GRCm39) T16A possibly damaging Het
Or9i16 A T 19: 13,865,381 (GRCm39) H64Q probably damaging Het
Oxtr C T 6: 112,466,713 (GRCm39) G16R probably benign Het
Pdgfrb A T 18: 61,201,829 (GRCm39) K464N probably benign Het
Pja2 A T 17: 64,620,025 (GRCm39) M1K probably null Het
Pkhd1 A T 1: 20,573,280 (GRCm39) N1875K probably damaging Het
Pogz T C 3: 94,787,491 (GRCm39) S1360P possibly damaging Het
Proc A T 18: 32,256,512 (GRCm39) L385Q probably damaging Het
Ptprm A G 17: 67,402,492 (GRCm39) I132T probably benign Het
Rpgr A G X: 10,062,255 (GRCm39) S343P probably benign Het
Rsu1 T C 2: 13,174,815 (GRCm39) Y225C probably damaging Het
Scyl1 A G 19: 5,820,481 (GRCm39) S118P probably damaging Het
Sec61a1 T C 6: 88,483,131 (GRCm39) N414D probably benign Het
Secisbp2l C T 2: 125,582,657 (GRCm39) G933D possibly damaging Het
Sema7a A G 9: 57,860,834 (GRCm39) D65G probably benign Het
Slc25a45 A G 19: 5,934,464 (GRCm39) Y144C probably damaging Het
Slc26a6 A G 9: 108,733,579 (GRCm39) Y103C probably damaging Het
Stat3 C T 11: 100,794,500 (GRCm39) D270N probably damaging Het
Taar8b T C 10: 23,967,736 (GRCm39) S153G probably benign Het
Top1 A G 2: 160,562,885 (GRCm39) E697G possibly damaging Het
Trappc11 G A 8: 47,966,801 (GRCm39) T470I probably damaging Het
Ttc7b G A 12: 100,466,376 (GRCm39) R79C probably damaging Het
Usp29 A G 7: 6,965,479 (GRCm39) T441A probably benign Het
Vmn2r110 A T 17: 20,804,029 (GRCm39) L182* probably null Het
Zgrf1 T C 3: 127,394,679 (GRCm39) I1345T probably benign Het
Zscan25 G T 5: 145,227,815 (GRCm39) R493L probably benign Het
Other mutations in Cep162
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00422:Cep162 APN 9 87,109,220 (GRCm39) missense probably benign 0.24
IGL00584:Cep162 APN 9 87,103,143 (GRCm39) splice site probably benign
IGL01387:Cep162 APN 9 87,093,864 (GRCm39) missense probably benign 0.08
IGL01862:Cep162 APN 9 87,135,986 (GRCm39) missense possibly damaging 0.90
IGL02304:Cep162 APN 9 87,109,200 (GRCm39) splice site probably benign
IGL02558:Cep162 APN 9 87,107,779 (GRCm39) missense probably benign
IGL02558:Cep162 APN 9 87,107,786 (GRCm39) missense probably benign 0.04
IGL02602:Cep162 APN 9 87,128,206 (GRCm39) missense probably benign 0.19
IGL02636:Cep162 APN 9 87,130,432 (GRCm39) missense possibly damaging 0.90
IGL02680:Cep162 APN 9 87,128,797 (GRCm39) missense possibly damaging 0.64
IGL03195:Cep162 APN 9 87,107,839 (GRCm39) missense probably benign 0.00
circus UTSW 9 87,088,915 (GRCm39) missense probably damaging 1.00
moscow UTSW 9 87,075,750 (GRCm39) missense probably damaging 1.00
smiley UTSW 9 87,099,134 (GRCm39) nonsense probably null
PIT4378001:Cep162 UTSW 9 87,099,198 (GRCm39) missense probably benign 0.01
PIT4431001:Cep162 UTSW 9 87,126,398 (GRCm39) missense probably benign 0.00
PIT4434001:Cep162 UTSW 9 87,075,701 (GRCm39) missense probably damaging 1.00
R0060:Cep162 UTSW 9 87,119,878 (GRCm39) splice site probably benign
R0218:Cep162 UTSW 9 87,093,862 (GRCm39) missense possibly damaging 0.73
R0366:Cep162 UTSW 9 87,102,537 (GRCm39) missense probably damaging 0.96
R0468:Cep162 UTSW 9 87,075,750 (GRCm39) missense probably damaging 1.00
R0764:Cep162 UTSW 9 87,083,798 (GRCm39) missense probably damaging 1.00
R1386:Cep162 UTSW 9 87,103,255 (GRCm39) missense probably benign
R1614:Cep162 UTSW 9 87,094,985 (GRCm39) missense probably damaging 1.00
R1633:Cep162 UTSW 9 87,085,736 (GRCm39) missense probably benign 0.23
R1831:Cep162 UTSW 9 87,088,985 (GRCm39) missense probably damaging 1.00
R1847:Cep162 UTSW 9 87,086,133 (GRCm39) missense probably benign 0.06
R1941:Cep162 UTSW 9 87,082,048 (GRCm39) missense probably benign 0.14
R2228:Cep162 UTSW 9 87,126,384 (GRCm39) missense probably benign 0.05
R2256:Cep162 UTSW 9 87,088,967 (GRCm39) missense probably damaging 1.00
R2257:Cep162 UTSW 9 87,088,967 (GRCm39) missense probably damaging 1.00
R2936:Cep162 UTSW 9 87,109,467 (GRCm39) missense probably benign
R3005:Cep162 UTSW 9 87,114,113 (GRCm39) missense probably benign 0.00
R3508:Cep162 UTSW 9 87,114,030 (GRCm39) critical splice donor site probably null
R3689:Cep162 UTSW 9 87,107,747 (GRCm39) nonsense probably null
R3743:Cep162 UTSW 9 87,099,230 (GRCm39) splice site probably benign
R4118:Cep162 UTSW 9 87,086,229 (GRCm39) missense probably benign 0.30
R4380:Cep162 UTSW 9 87,082,056 (GRCm39) missense probably damaging 0.99
R4450:Cep162 UTSW 9 87,107,861 (GRCm39) missense probably damaging 1.00
R4540:Cep162 UTSW 9 87,094,992 (GRCm39) missense probably damaging 1.00
R4700:Cep162 UTSW 9 87,088,915 (GRCm39) missense probably damaging 1.00
R4941:Cep162 UTSW 9 87,108,022 (GRCm39) intron probably benign
R5356:Cep162 UTSW 9 87,088,948 (GRCm39) missense probably damaging 1.00
R5468:Cep162 UTSW 9 87,109,290 (GRCm39) missense probably benign 0.00
R5579:Cep162 UTSW 9 87,085,724 (GRCm39) missense probably benign 0.26
R5859:Cep162 UTSW 9 87,086,145 (GRCm39) missense probably damaging 1.00
R6114:Cep162 UTSW 9 87,085,763 (GRCm39) missense probably benign
R6143:Cep162 UTSW 9 87,094,904 (GRCm39) critical splice donor site probably null
R6422:Cep162 UTSW 9 87,114,069 (GRCm39) missense possibly damaging 0.92
R6517:Cep162 UTSW 9 87,104,227 (GRCm39) missense probably damaging 0.99
R6576:Cep162 UTSW 9 87,099,198 (GRCm39) missense probably benign 0.01
R6782:Cep162 UTSW 9 87,093,737 (GRCm39) missense probably benign 0.07
R6867:Cep162 UTSW 9 87,099,134 (GRCm39) nonsense probably null
R7293:Cep162 UTSW 9 87,085,836 (GRCm39) missense probably benign 0.01
R7355:Cep162 UTSW 9 87,136,008 (GRCm39) nonsense probably null
R7391:Cep162 UTSW 9 87,130,547 (GRCm39) nonsense probably null
R7426:Cep162 UTSW 9 87,074,819 (GRCm39) missense probably damaging 1.00
R7593:Cep162 UTSW 9 87,086,250 (GRCm39) missense probably benign 0.40
R7710:Cep162 UTSW 9 87,114,172 (GRCm39) missense probably damaging 1.00
R7841:Cep162 UTSW 9 87,126,369 (GRCm39) missense probably benign 0.00
R7949:Cep162 UTSW 9 87,088,901 (GRCm39) missense probably benign 0.04
R8351:Cep162 UTSW 9 87,074,903 (GRCm39) nonsense probably null
R8451:Cep162 UTSW 9 87,074,903 (GRCm39) nonsense probably null
R8552:Cep162 UTSW 9 87,126,361 (GRCm39) missense probably benign 0.34
R8755:Cep162 UTSW 9 87,114,064 (GRCm39) missense probably benign 0.02
R8762:Cep162 UTSW 9 87,109,314 (GRCm39) missense probably benign 0.00
R9640:Cep162 UTSW 9 87,126,352 (GRCm39) missense probably benign 0.06
X0063:Cep162 UTSW 9 87,104,095 (GRCm39) critical splice donor site probably null
Z1177:Cep162 UTSW 9 87,082,033 (GRCm39) critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AAACCGAGCTTCTTTTGGTTC -3'
(R):5'- TCAATGAAGAGCTGGCAGC -3'

Sequencing Primer
(F):5'- AAACCGAGCTTCTTTTGGTTCTCATG -3'
(R):5'- CTGGCAGCGAAGGGGAG -3'
Posted On 2015-09-25