Incidental Mutation 'R4598:Slc26a6'
ID345368
Institutional Source Beutler Lab
Gene Symbol Slc26a6
Ensembl Gene ENSMUSG00000023259
Gene Namesolute carrier family 26, member 6
SynonymsPat1, B930010B04Rik, CFEX
MMRRC Submission 041814-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.148) question?
Stock #R4598 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location108853283-108913049 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 108856380 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 103 (Y103C)
Ref Sequence ENSEMBL: ENSMUSP00000141409 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024238] [ENSMUST00000098376] [ENSMUST00000188557] [ENSMUST00000192507] [ENSMUST00000192559] [ENSMUST00000193291] [ENSMUST00000193874]
Predicted Effect probably benign
Transcript: ENSMUST00000024238
SMART Domains Protein: ENSMUSP00000024238
Gene: ENSMUSG00000023473

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
low complexity region 264 293 N/A INTRINSIC
CA 338 422 2.25e-27 SMART
CA 446 534 5.05e-30 SMART
CA 558 640 7.6e-25 SMART
CA 664 745 7.36e-32 SMART
CA 769 847 5.95e-18 SMART
CA 871 950 5.25e-28 SMART
CA 974 1056 2.67e-29 SMART
CA 1080 1158 1.18e-21 SMART
CA 1186 1262 3.2e-1 SMART
low complexity region 1328 1335 N/A INTRINSIC
low complexity region 1350 1360 N/A INTRINSIC
EGF 1369 1424 1.02e-2 SMART
EGF 1429 1464 3.23e0 SMART
EGF 1467 1503 8.78e-2 SMART
LamG 1524 1691 2.27e-35 SMART
EGF 1714 1747 4.22e-4 SMART
LamG 1774 1913 9.02e-21 SMART
EGF 1938 1971 2.43e-4 SMART
EGF 1973 2009 1.3e-4 SMART
EGF_Lam 2066 2111 5.08e-7 SMART
HormR 2114 2176 3.42e-21 SMART
Pfam:GAIN 2188 2441 1.1e-57 PFAM
GPS 2467 2520 7.92e-20 SMART
Pfam:7tm_2 2527 2758 1.5e-56 PFAM
low complexity region 2813 2829 N/A INTRINSIC
low complexity region 2882 2906 N/A INTRINSIC
low complexity region 3058 3072 N/A INTRINSIC
low complexity region 3149 3189 N/A INTRINSIC
low complexity region 3239 3261 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000098376
AA Change: Y103C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000095979
Gene: ENSMUSG00000023259
AA Change: Y103C

DomainStartEndE-ValueType
Pfam:Sulfate_transp 69 458 4.4e-113 PFAM
low complexity region 471 484 N/A INTRINSIC
PDB:3LLO|A 489 546 2e-16 PDB
low complexity region 554 593 N/A INTRINSIC
low complexity region 638 650 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000188557
AA Change: Y103C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000140849
Gene: ENSMUSG00000023259
AA Change: Y103C

DomainStartEndE-ValueType
Pfam:Sulfate_tra_GLY 54 137 4.1e-33 PFAM
Pfam:Sulfate_transp 176 454 1.9e-67 PFAM
low complexity region 471 484 N/A INTRINSIC
PDB:3LLO|A 489 546 6e-16 PDB
low complexity region 554 593 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000192507
AA Change: Y103C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000141336
Gene: ENSMUSG00000023259
AA Change: Y103C

DomainStartEndE-ValueType
Pfam:Sulfate_tra_GLY 54 137 4.1e-33 PFAM
Pfam:Sulfate_transp 176 454 1.9e-67 PFAM
low complexity region 471 484 N/A INTRINSIC
PDB:3LLO|A 489 546 6e-16 PDB
low complexity region 554 593 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000192559
AA Change: Y103C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000141632
Gene: ENSMUSG00000023259
AA Change: Y103C

DomainStartEndE-ValueType
Pfam:Sulfate_tra_GLY 54 137 7.7e-34 PFAM
Pfam:Sulfate_transp 176 225 1.8e-5 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000193291
AA Change: Y103C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000142250
Gene: ENSMUSG00000023259
AA Change: Y103C

DomainStartEndE-ValueType
Pfam:Sulfate_tra_GLY 54 137 4.1e-33 PFAM
Pfam:Sulfate_transp 176 454 1.9e-67 PFAM
low complexity region 471 484 N/A INTRINSIC
PDB:3LLO|A 489 546 6e-16 PDB
low complexity region 554 593 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193463
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193825
Predicted Effect probably damaging
Transcript: ENSMUST00000193874
AA Change: Y103C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000141409
Gene: ENSMUSG00000023259
AA Change: Y103C

DomainStartEndE-ValueType
Pfam:Sulfate_tra_GLY 54 137 7.7e-34 PFAM
Pfam:Sulfate_transp 176 225 1.8e-5 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195646
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the solute carrier 26 family, whose members encode anion transporter proteins. This particular family member encodes a protein involved in transporting chloride, oxalate, sulfate and bicarbonate. Alternatively spliced transcript variants encoding distinct isoforms have been described. [provided by RefSeq, Aug 2013]
PHENOTYPE: Homozygous null mice display abnormal proximal tubule and duodenal anion exchange, but are otherwise normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830018L16Rik G A 1: 11,747,964 probably null Het
Abca14 T C 7: 120,255,403 V930A probably benign Het
Abcb7 A C X: 104,323,382 D135E probably benign Het
Ace T A 11: 105,981,759 probably null Het
Acnat1 T C 4: 49,450,781 D110G probably benign Het
Ak9 C T 10: 41,383,911 P862S probably damaging Het
Atp1a3 A G 7: 24,979,341 S972P probably damaging Het
Bmf C A 2: 118,549,128 A56S probably benign Het
C6 T C 15: 4,763,370 L319P possibly damaging Het
Cab39 A G 1: 85,848,329 Y249C probably damaging Het
Cdc14b T C 13: 64,247,274 T69A probably benign Het
Cep162 A G 9: 87,203,795 Y1159H possibly damaging Het
Chrna7 A G 7: 63,103,790 M327T probably damaging Het
Clca3a2 A T 3: 144,805,683 N41K probably damaging Het
Clock T C 5: 76,235,810 M499V probably benign Het
Col5a3 A G 9: 20,774,559 probably null Het
Coq6 T C 12: 84,362,139 V30A probably benign Het
Cyp3a57 A G 5: 145,390,417 I473V probably benign Het
D430041D05Rik A T 2: 104,208,183 V1547D probably damaging Het
Dhx9 TCC TC 1: 153,467,051 probably null Het
Dock2 T A 11: 34,239,536 Y1545F probably damaging Het
Eif4e3 T A 6: 99,640,710 I67L probably benign Het
Epor A G 9: 21,961,859 S86P probably benign Het
Esp31 T A 17: 38,641,121 probably null Het
Esrp2 A G 8: 106,132,711 M498T probably damaging Het
F5 T C 1: 164,204,797 I1771T probably benign Het
Fancd2 C A 6: 113,585,477 H1259Q probably benign Het
Gale C A 4: 135,967,837 S341* probably null Het
Ints12 T A 3: 133,098,453 I67N probably benign Het
Kat2b A G 17: 53,670,798 Y791C probably benign Het
Kazn A G 4: 142,210,092 V108A possibly damaging Het
Kcnma1 T C 14: 23,803,160 T109A probably damaging Het
Med13 T C 11: 86,278,566 T1955A probably damaging Het
Megf10 G A 18: 57,189,603 probably null Het
Megf10 A T 18: 57,287,812 S841C probably damaging Het
Mep1a A G 17: 43,491,578 probably null Het
Mrap2 A T 9: 87,182,789 E194D probably damaging Het
Msh2 A G 17: 87,708,578 K546R probably damaging Het
Ndc80 T C 17: 71,521,068 D88G probably damaging Het
Nrip1 A G 16: 76,293,080 F530L probably damaging Het
Olfr1380 T C 11: 49,564,718 S266P probably damaging Het
Olfr1504 A T 19: 13,888,017 H64Q probably damaging Het
Olfr676 A C 7: 105,036,073 I292L probably benign Het
Olfr812 T C 10: 129,842,995 T16A possibly damaging Het
Oxtr C T 6: 112,489,752 G16R probably benign Het
Pdgfrb A T 18: 61,068,757 K464N probably benign Het
Pja2 A T 17: 64,313,030 M1K probably null Het
Pkhd1 A T 1: 20,503,056 N1875K probably damaging Het
Pogz T C 3: 94,880,180 S1360P possibly damaging Het
Proc A T 18: 32,123,459 L385Q probably damaging Het
Ptprm A G 17: 67,095,497 I132T probably benign Het
Rpgr A G X: 10,196,016 S343P probably benign Het
Rsu1 T C 2: 13,170,004 Y225C probably damaging Het
Scyl1 A G 19: 5,770,453 S118P probably damaging Het
Sec61a1 T C 6: 88,506,149 N414D probably benign Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Sema7a A G 9: 57,953,551 D65G probably benign Het
Slc25a45 A G 19: 5,884,436 Y144C probably damaging Het
Stat3 C T 11: 100,903,674 D270N probably damaging Het
Taar8b T C 10: 24,091,838 S153G probably benign Het
Top1 A G 2: 160,720,965 E697G possibly damaging Het
Trappc11 G A 8: 47,513,766 T470I probably damaging Het
Ttc7b G A 12: 100,500,117 R79C probably damaging Het
Usp29 A G 7: 6,962,480 T441A probably benign Het
Vmn2r110 A T 17: 20,583,767 L182* probably null Het
Zgrf1 T C 3: 127,601,030 I1345T probably benign Het
Zscan25 G T 5: 145,291,005 R493L probably benign Het
Other mutations in Slc26a6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00467:Slc26a6 APN 9 108855889 missense probably benign
IGL02447:Slc26a6 APN 9 108857052 missense probably benign 0.03
IGL03090:Slc26a6 APN 9 108860691 missense probably benign 0.06
R0018:Slc26a6 UTSW 9 108858922 splice site probably null
R0083:Slc26a6 UTSW 9 108859113 splice site probably null
R0133:Slc26a6 UTSW 9 108861323 missense possibly damaging 0.86
R0135:Slc26a6 UTSW 9 108860595 splice site probably benign
R0563:Slc26a6 UTSW 9 108857670 missense probably damaging 1.00
R0661:Slc26a6 UTSW 9 108859113 splice site probably null
R1513:Slc26a6 UTSW 9 108855836 missense probably benign 0.41
R1746:Slc26a6 UTSW 9 108861717 missense probably benign 0.00
R2079:Slc26a6 UTSW 9 108859058 missense probably damaging 0.97
R2939:Slc26a6 UTSW 9 108857037 missense probably benign 0.05
R2940:Slc26a6 UTSW 9 108857037 missense probably benign 0.05
R3833:Slc26a6 UTSW 9 108855918 missense possibly damaging 0.86
R3861:Slc26a6 UTSW 9 108854196 unclassified probably benign
R4175:Slc26a6 UTSW 9 108854217 unclassified probably benign
R4358:Slc26a6 UTSW 9 108861783 missense probably benign 0.00
R4403:Slc26a6 UTSW 9 108855938 missense probably benign
R4660:Slc26a6 UTSW 9 108861341 missense probably damaging 0.96
R4663:Slc26a6 UTSW 9 108857907 missense probably damaging 0.98
R5296:Slc26a6 UTSW 9 108860646 missense probably damaging 1.00
R5390:Slc26a6 UTSW 9 108861300 splice site probably benign
R5533:Slc26a6 UTSW 9 108857956 missense probably damaging 1.00
R5662:Slc26a6 UTSW 9 108859339 missense possibly damaging 0.94
R5845:Slc26a6 UTSW 9 108862083 missense possibly damaging 0.46
R6547:Slc26a6 UTSW 9 108860782 intron probably null
R7079:Slc26a6 UTSW 9 108857948 missense probably damaging 1.00
R7652:Slc26a6 UTSW 9 108855944 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- ACCTCAGGGTTGCAAGTTCTG -3'
(R):5'- GGGCTTTGAGATATTCAGCAC -3'

Sequencing Primer
(F):5'- TGGTCTGTGAAGTGTCAAACCAG -3'
(R):5'- GGGCTTTGAGATATTCAGCACCTAAG -3'
Posted On2015-09-25