Incidental Mutation 'R4598:Med13'
ID 345374
Institutional Source Beutler Lab
Gene Symbol Med13
Ensembl Gene ENSMUSG00000034297
Gene Name mediator complex subunit 13
Synonyms 1110067M05Rik, Thrap1, Trap240
MMRRC Submission 041814-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.951) question?
Stock # R4598 (G1)
Quality Score 225
Status Not validated
Chromosome 11
Chromosomal Location 86157859-86248422 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 86169392 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 1955 (T1955A)
Ref Sequence ENSEMBL: ENSMUSP00000044268 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043624]
AlphaFold Q5SWW4
Predicted Effect probably damaging
Transcript: ENSMUST00000043624
AA Change: T1955A

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000044268
Gene: ENSMUSG00000034297
AA Change: T1955A

DomainStartEndE-ValueType
Pfam:Med13_N 1 384 5e-130 PFAM
low complexity region 438 451 N/A INTRINSIC
low complexity region 531 540 N/A INTRINSIC
low complexity region 796 814 N/A INTRINSIC
low complexity region 984 998 N/A INTRINSIC
low complexity region 1001 1029 N/A INTRINSIC
low complexity region 1463 1476 N/A INTRINSIC
low complexity region 1502 1517 N/A INTRINSIC
low complexity region 1522 1550 N/A INTRINSIC
low complexity region 1559 1570 N/A INTRINSIC
low complexity region 1577 1596 N/A INTRINSIC
Pfam:Med13_C 1637 2161 3.5e-146 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136622
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140514
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143819
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of the mediator complex (also known as TRAP, SMCC, DRIP, or ARC), a transcriptional coactivator complex thought to be required for the expression of almost all genes. The mediator complex is recruited by transcriptional activators or nuclear receptors to induce gene expression, possibly by interacting with RNA polymerase II and promoting the formation of a transcriptional pre-initiation complex. The product of this gene is proposed to form a sub-complex with MED12, cyclin C, and CDK8 that can negatively regulate transactivation by mediator. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a conditional allele exhibited in the heart exhibit increased susceptibility to obesity and worsened glucose intolerance when fed a high fat diet. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830018L16Rik G A 1: 11,818,188 (GRCm39) probably null Het
Abca14 T C 7: 119,854,626 (GRCm39) V930A probably benign Het
Abcb7 A C X: 103,366,988 (GRCm39) D135E probably benign Het
Ace T A 11: 105,872,585 (GRCm39) probably null Het
Acnat1 T C 4: 49,450,781 (GRCm39) D110G probably benign Het
Ak9 C T 10: 41,259,907 (GRCm39) P862S probably damaging Het
Atp1a3 A G 7: 24,678,766 (GRCm39) S972P probably damaging Het
Bmf C A 2: 118,379,609 (GRCm39) A56S probably benign Het
C6 T C 15: 4,792,852 (GRCm39) L319P possibly damaging Het
Cab39 A G 1: 85,776,050 (GRCm39) Y249C probably damaging Het
Cdc14b T C 13: 64,395,088 (GRCm39) T69A probably benign Het
Cep162 A G 9: 87,085,848 (GRCm39) Y1159H possibly damaging Het
Chrna7 A G 7: 62,753,538 (GRCm39) M327T probably damaging Het
Clca3a2 A T 3: 144,511,444 (GRCm39) N41K probably damaging Het
Clock T C 5: 76,383,657 (GRCm39) M499V probably benign Het
Col5a3 A G 9: 20,685,855 (GRCm39) probably null Het
Coq6 T C 12: 84,408,913 (GRCm39) V30A probably benign Het
Cyp3a57 A G 5: 145,327,227 (GRCm39) I473V probably benign Het
D430041D05Rik A T 2: 104,038,528 (GRCm39) V1547D probably damaging Het
Dhx9 TCC TC 1: 153,342,797 (GRCm39) probably null Het
Dock2 T A 11: 34,189,536 (GRCm39) Y1545F probably damaging Het
Eif4e3 T A 6: 99,617,671 (GRCm39) I67L probably benign Het
Epor A G 9: 21,873,155 (GRCm39) S86P probably benign Het
Esp31 T A 17: 38,952,012 (GRCm39) probably null Het
Esrp2 A G 8: 106,859,343 (GRCm39) M498T probably damaging Het
F5 T C 1: 164,032,366 (GRCm39) I1771T probably benign Het
Fancd2 C A 6: 113,562,438 (GRCm39) H1259Q probably benign Het
Gale C A 4: 135,695,148 (GRCm39) S341* probably null Het
Ints12 T A 3: 132,804,214 (GRCm39) I67N probably benign Het
Kat2b A G 17: 53,977,826 (GRCm39) Y791C probably benign Het
Kazn A G 4: 141,937,403 (GRCm39) V108A possibly damaging Het
Kcnma1 T C 14: 23,853,228 (GRCm39) T109A probably damaging Het
Megf10 A T 18: 57,420,884 (GRCm39) S841C probably damaging Het
Megf10 G A 18: 57,322,675 (GRCm39) probably null Het
Mep1a A G 17: 43,802,469 (GRCm39) probably null Het
Mrap2 A T 9: 87,064,842 (GRCm39) E194D probably damaging Het
Msh2 A G 17: 88,016,006 (GRCm39) K546R probably damaging Het
Ndc80 T C 17: 71,828,063 (GRCm39) D88G probably damaging Het
Nrip1 A G 16: 76,089,968 (GRCm39) F530L probably damaging Het
Or2y10 T C 11: 49,455,545 (GRCm39) S266P probably damaging Het
Or52e7 A C 7: 104,685,280 (GRCm39) I292L probably benign Het
Or6c216 T C 10: 129,678,864 (GRCm39) T16A possibly damaging Het
Or9i16 A T 19: 13,865,381 (GRCm39) H64Q probably damaging Het
Oxtr C T 6: 112,466,713 (GRCm39) G16R probably benign Het
Pdgfrb A T 18: 61,201,829 (GRCm39) K464N probably benign Het
Pja2 A T 17: 64,620,025 (GRCm39) M1K probably null Het
Pkhd1 A T 1: 20,573,280 (GRCm39) N1875K probably damaging Het
Pogz T C 3: 94,787,491 (GRCm39) S1360P possibly damaging Het
Proc A T 18: 32,256,512 (GRCm39) L385Q probably damaging Het
Ptprm A G 17: 67,402,492 (GRCm39) I132T probably benign Het
Rpgr A G X: 10,062,255 (GRCm39) S343P probably benign Het
Rsu1 T C 2: 13,174,815 (GRCm39) Y225C probably damaging Het
Scyl1 A G 19: 5,820,481 (GRCm39) S118P probably damaging Het
Sec61a1 T C 6: 88,483,131 (GRCm39) N414D probably benign Het
Secisbp2l C T 2: 125,582,657 (GRCm39) G933D possibly damaging Het
Sema7a A G 9: 57,860,834 (GRCm39) D65G probably benign Het
Slc25a45 A G 19: 5,934,464 (GRCm39) Y144C probably damaging Het
Slc26a6 A G 9: 108,733,579 (GRCm39) Y103C probably damaging Het
Stat3 C T 11: 100,794,500 (GRCm39) D270N probably damaging Het
Taar8b T C 10: 23,967,736 (GRCm39) S153G probably benign Het
Top1 A G 2: 160,562,885 (GRCm39) E697G possibly damaging Het
Trappc11 G A 8: 47,966,801 (GRCm39) T470I probably damaging Het
Ttc7b G A 12: 100,466,376 (GRCm39) R79C probably damaging Het
Usp29 A G 7: 6,965,479 (GRCm39) T441A probably benign Het
Vmn2r110 A T 17: 20,804,029 (GRCm39) L182* probably null Het
Zgrf1 T C 3: 127,394,679 (GRCm39) I1345T probably benign Het
Zscan25 G T 5: 145,227,815 (GRCm39) R493L probably benign Het
Other mutations in Med13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00960:Med13 APN 11 86,181,866 (GRCm39) splice site probably benign
IGL01391:Med13 APN 11 86,219,323 (GRCm39) missense probably benign
IGL01767:Med13 APN 11 86,210,609 (GRCm39) missense probably benign 0.38
IGL01830:Med13 APN 11 86,179,754 (GRCm39) splice site probably benign
IGL01859:Med13 APN 11 86,174,577 (GRCm39) missense possibly damaging 0.86
IGL01924:Med13 APN 11 86,199,522 (GRCm39) splice site probably benign
IGL02080:Med13 APN 11 86,174,638 (GRCm39) missense probably damaging 0.97
IGL02138:Med13 APN 11 86,177,591 (GRCm39) missense probably damaging 0.99
IGL02259:Med13 APN 11 86,248,327 (GRCm39) missense possibly damaging 0.89
IGL02339:Med13 APN 11 86,179,765 (GRCm39) missense probably benign 0.16
IGL02399:Med13 APN 11 86,174,771 (GRCm39) splice site probably benign
IGL02646:Med13 APN 11 86,174,212 (GRCm39) missense probably benign 0.00
IGL03227:Med13 APN 11 86,218,618 (GRCm39) splice site probably benign
R0197_Med13_854 UTSW 11 86,197,864 (GRCm39) missense probably benign 0.13
R0360_Med13_060 UTSW 11 86,219,987 (GRCm39) splice site probably benign
R2359_Med13_079 UTSW 11 86,181,861 (GRCm39) splice site probably benign
R3735_Med13_085 UTSW 11 86,170,484 (GRCm39) missense probably benign 0.00
R4974_Med13_508 UTSW 11 86,189,673 (GRCm39) missense probably damaging 0.98
R0116:Med13 UTSW 11 86,210,723 (GRCm39) missense probably damaging 0.99
R0189:Med13 UTSW 11 86,210,702 (GRCm39) missense probably benign
R0197:Med13 UTSW 11 86,197,864 (GRCm39) missense probably benign 0.13
R0206:Med13 UTSW 11 86,191,682 (GRCm39) splice site probably benign
R0208:Med13 UTSW 11 86,191,682 (GRCm39) splice site probably benign
R0310:Med13 UTSW 11 86,236,829 (GRCm39) missense probably benign 0.11
R0360:Med13 UTSW 11 86,219,987 (GRCm39) splice site probably benign
R0413:Med13 UTSW 11 86,190,033 (GRCm39) splice site probably benign
R0482:Med13 UTSW 11 86,175,977 (GRCm39) missense probably benign 0.41
R0497:Med13 UTSW 11 86,167,809 (GRCm39) splice site probably benign
R0589:Med13 UTSW 11 86,174,075 (GRCm39) missense probably damaging 1.00
R0601:Med13 UTSW 11 86,236,788 (GRCm39) missense possibly damaging 0.47
R0646:Med13 UTSW 11 86,221,915 (GRCm39) missense possibly damaging 0.95
R0701:Med13 UTSW 11 86,197,864 (GRCm39) missense probably benign 0.13
R0709:Med13 UTSW 11 86,210,422 (GRCm39) missense possibly damaging 0.95
R0711:Med13 UTSW 11 86,192,179 (GRCm39) splice site probably benign
R0734:Med13 UTSW 11 86,192,063 (GRCm39) missense probably benign
R0883:Med13 UTSW 11 86,197,864 (GRCm39) missense probably benign 0.13
R1793:Med13 UTSW 11 86,220,177 (GRCm39) missense probably benign 0.45
R1926:Med13 UTSW 11 86,179,899 (GRCm39) missense possibly damaging 0.47
R1959:Med13 UTSW 11 86,189,805 (GRCm39) missense probably damaging 1.00
R2286:Med13 UTSW 11 86,210,515 (GRCm39) missense probably benign 0.05
R2359:Med13 UTSW 11 86,181,861 (GRCm39) splice site probably benign
R2444:Med13 UTSW 11 86,222,786 (GRCm39) missense probably damaging 1.00
R2679:Med13 UTSW 11 86,189,403 (GRCm39) missense probably benign 0.00
R2879:Med13 UTSW 11 86,189,988 (GRCm39) missense possibly damaging 0.61
R3439:Med13 UTSW 11 86,176,123 (GRCm39) missense probably damaging 1.00
R3735:Med13 UTSW 11 86,170,484 (GRCm39) missense probably benign 0.00
R4333:Med13 UTSW 11 86,179,009 (GRCm39) missense probably benign
R4558:Med13 UTSW 11 86,189,880 (GRCm39) missense probably damaging 1.00
R4773:Med13 UTSW 11 86,167,746 (GRCm39) missense probably damaging 0.99
R4801:Med13 UTSW 11 86,169,599 (GRCm39) missense probably damaging 1.00
R4802:Med13 UTSW 11 86,169,599 (GRCm39) missense probably damaging 1.00
R4806:Med13 UTSW 11 86,189,403 (GRCm39) missense probably benign 0.00
R4940:Med13 UTSW 11 86,178,944 (GRCm39) missense probably damaging 1.00
R4974:Med13 UTSW 11 86,189,673 (GRCm39) missense probably damaging 0.98
R5056:Med13 UTSW 11 86,219,391 (GRCm39) missense probably benign 0.00
R5133:Med13 UTSW 11 86,210,675 (GRCm39) missense probably benign 0.32
R5206:Med13 UTSW 11 86,210,705 (GRCm39) missense probably damaging 1.00
R5352:Med13 UTSW 11 86,192,294 (GRCm39) missense possibly damaging 0.82
R5534:Med13 UTSW 11 86,210,191 (GRCm39) missense probably benign 0.09
R5556:Med13 UTSW 11 86,218,664 (GRCm39) missense probably benign 0.25
R5633:Med13 UTSW 11 86,169,757 (GRCm39) splice site probably benign
R5769:Med13 UTSW 11 86,236,829 (GRCm39) missense probably benign 0.11
R6236:Med13 UTSW 11 86,219,357 (GRCm39) missense probably damaging 0.99
R6479:Med13 UTSW 11 86,248,353 (GRCm39) start gained probably benign
R6487:Med13 UTSW 11 86,221,976 (GRCm39) missense probably damaging 1.00
R6524:Med13 UTSW 11 86,192,293 (GRCm39) missense probably damaging 0.98
R6528:Med13 UTSW 11 86,189,780 (GRCm39) missense probably damaging 1.00
R6805:Med13 UTSW 11 86,169,622 (GRCm39) missense possibly damaging 0.48
R6913:Med13 UTSW 11 86,210,702 (GRCm39) missense probably benign
R7221:Med13 UTSW 11 86,178,921 (GRCm39) missense probably benign 0.00
R7254:Med13 UTSW 11 86,210,661 (GRCm39) missense probably benign
R7267:Med13 UTSW 11 86,199,652 (GRCm39) missense probably benign 0.01
R7309:Med13 UTSW 11 86,181,888 (GRCm39) missense probably benign 0.00
R7404:Med13 UTSW 11 86,177,272 (GRCm39) missense possibly damaging 0.53
R7586:Med13 UTSW 11 86,161,828 (GRCm39) missense probably damaging 0.99
R7704:Med13 UTSW 11 86,236,744 (GRCm39) nonsense probably null
R7922:Med13 UTSW 11 86,161,831 (GRCm39) missense probably damaging 0.98
R7943:Med13 UTSW 11 86,169,352 (GRCm39) missense probably damaging 0.97
R8062:Med13 UTSW 11 86,210,264 (GRCm39) missense probably benign
R8075:Med13 UTSW 11 86,163,296 (GRCm39) missense probably damaging 0.98
R8207:Med13 UTSW 11 86,194,375 (GRCm39) missense probably damaging 1.00
R8671:Med13 UTSW 11 86,161,923 (GRCm39) missense probably damaging 1.00
R9056:Med13 UTSW 11 86,189,660 (GRCm39) nonsense probably null
R9084:Med13 UTSW 11 86,191,621 (GRCm39) missense probably damaging 1.00
R9148:Med13 UTSW 11 86,192,297 (GRCm39) missense probably benign 0.27
R9329:Med13 UTSW 11 86,189,283 (GRCm39) missense probably benign 0.10
R9380:Med13 UTSW 11 86,177,598 (GRCm39) missense probably benign 0.42
R9515:Med13 UTSW 11 86,199,727 (GRCm39) missense probably benign 0.00
R9516:Med13 UTSW 11 86,179,801 (GRCm39) missense probably benign 0.01
R9690:Med13 UTSW 11 86,169,670 (GRCm39) missense probably damaging 1.00
R9751:Med13 UTSW 11 86,189,984 (GRCm39) missense probably damaging 1.00
R9752:Med13 UTSW 11 86,174,147 (GRCm39) missense possibly damaging 0.87
R9764:Med13 UTSW 11 86,177,345 (GRCm39) missense possibly damaging 0.89
Z1176:Med13 UTSW 11 86,246,249 (GRCm39) missense probably damaging 1.00
Z1176:Med13 UTSW 11 86,236,688 (GRCm39) missense probably benign 0.45
Z1176:Med13 UTSW 11 86,219,370 (GRCm39) missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- GGGCAAGTACTAGGCCAAAC -3'
(R):5'- AAGGTTCTTTTGTTATCATGCCAGG -3'

Sequencing Primer
(F):5'- CCAAACAGGGCTGTATAGAAAGACC -3'
(R):5'- ATCATGCCAGGTTAGTTATGTTCAG -3'
Posted On 2015-09-25