Incidental Mutation 'R4598:Kat2b'
ID 345388
Institutional Source Beutler Lab
Gene Symbol Kat2b
Ensembl Gene ENSMUSG00000000708
Gene Name K(lysine) acetyltransferase 2B
Synonyms Pcaf, A930006P13Rik
MMRRC Submission 041814-MU
Accession Numbers

Genbank: NM_020005

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R4598 (G1)
Quality Score 225
Status Not validated
Chromosome 17
Chromosomal Location 53566861-53672720 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 53670798 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 791 (Y791C)
Ref Sequence ENSEMBL: ENSMUSP00000000724 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000724] [ENSMUST00000024736] [ENSMUST00000166525]
AlphaFold Q9JHD1
Predicted Effect probably benign
Transcript: ENSMUST00000000724
AA Change: Y791C

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000000724
Gene: ENSMUSG00000000708
AA Change: Y791C

DomainStartEndE-ValueType
low complexity region 4 21 N/A INTRINSIC
low complexity region 32 55 N/A INTRINSIC
Pfam:PCAF_N 56 308 6.2e-114 PFAM
low complexity region 461 472 N/A INTRINSIC
Pfam:Acetyltransf_7 522 605 1.5e-11 PFAM
Pfam:Acetyltransf_1 530 604 3.2e-11 PFAM
low complexity region 643 659 N/A INTRINSIC
BROMO 702 810 1.08e-44 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000024736
SMART Domains Protein: ENSMUSP00000024736
Gene: ENSMUSG00000023940

DomainStartEndE-ValueType
Pfam:Shugoshin_N 22 66 6.2e-12 PFAM
low complexity region 273 290 N/A INTRINSIC
Pfam:Shugoshin_C 463 486 2.2e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000166525
Predicted Effect probably benign
Transcript: ENSMUST00000171072
SMART Domains Protein: ENSMUSP00000127807
Gene: ENSMUSG00000000708

DomainStartEndE-ValueType
SCOP:d1qsta_ 2 48 6e-26 SMART
PDB:1CM0|A 2 50 1e-28 PDB
low complexity region 54 70 N/A INTRINSIC
Blast:BROMO 71 98 2e-11 BLAST
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] CBP and p300 are large nuclear proteins that bind to many sequence-specific factors involved in cell growth and/or differentiation, including c-jun and the adenoviral oncoprotein E1A. The protein encoded by this gene associates with p300/CBP. It has in vitro and in vivo binding activity with CBP and p300, and competes with E1A for binding sites in p300/CBP. It has histone acetyl transferase activity with core histones and nucleosome core particles, indicating that this protein plays a direct role in transcriptional regulation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit no abrnomal phenotype. [provided by MGI curators]
Allele List at MGI

All alleles(122) : Targeted, knock-out(2) Targeted, other(1) Gene trapped(119)

Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830018L16Rik G A 1: 11,747,964 probably null Het
Abca14 T C 7: 120,255,403 V930A probably benign Het
Abcb7 A C X: 104,323,382 D135E probably benign Het
Ace T A 11: 105,981,759 probably null Het
Acnat1 T C 4: 49,450,781 D110G probably benign Het
Ak9 C T 10: 41,383,911 P862S probably damaging Het
Atp1a3 A G 7: 24,979,341 S972P probably damaging Het
Bmf C A 2: 118,549,128 A56S probably benign Het
C6 T C 15: 4,763,370 L319P possibly damaging Het
Cab39 A G 1: 85,848,329 Y249C probably damaging Het
Cdc14b T C 13: 64,247,274 T69A probably benign Het
Cep162 A G 9: 87,203,795 Y1159H possibly damaging Het
Chrna7 A G 7: 63,103,790 M327T probably damaging Het
Clca3a2 A T 3: 144,805,683 N41K probably damaging Het
Clock T C 5: 76,235,810 M499V probably benign Het
Col5a3 A G 9: 20,774,559 probably null Het
Coq6 T C 12: 84,362,139 V30A probably benign Het
Cyp3a57 A G 5: 145,390,417 I473V probably benign Het
D430041D05Rik A T 2: 104,208,183 V1547D probably damaging Het
Dhx9 TCC TC 1: 153,467,051 probably null Het
Dock2 T A 11: 34,239,536 Y1545F probably damaging Het
Eif4e3 T A 6: 99,640,710 I67L probably benign Het
Epor A G 9: 21,961,859 S86P probably benign Het
Esp31 T A 17: 38,641,121 probably null Het
Esrp2 A G 8: 106,132,711 M498T probably damaging Het
F5 T C 1: 164,204,797 I1771T probably benign Het
Fancd2 C A 6: 113,585,477 H1259Q probably benign Het
Gale C A 4: 135,967,837 S341* probably null Het
Ints12 T A 3: 133,098,453 I67N probably benign Het
Kazn A G 4: 142,210,092 V108A possibly damaging Het
Kcnma1 T C 14: 23,803,160 T109A probably damaging Het
Med13 T C 11: 86,278,566 T1955A probably damaging Het
Megf10 A T 18: 57,287,812 S841C probably damaging Het
Megf10 G A 18: 57,189,603 probably null Het
Mep1a A G 17: 43,491,578 probably null Het
Mrap2 A T 9: 87,182,789 E194D probably damaging Het
Msh2 A G 17: 87,708,578 K546R probably damaging Het
Ndc80 T C 17: 71,521,068 D88G probably damaging Het
Nrip1 A G 16: 76,293,080 F530L probably damaging Het
Olfr1380 T C 11: 49,564,718 S266P probably damaging Het
Olfr1504 A T 19: 13,888,017 H64Q probably damaging Het
Olfr676 A C 7: 105,036,073 I292L probably benign Het
Olfr812 T C 10: 129,842,995 T16A possibly damaging Het
Oxtr C T 6: 112,489,752 G16R probably benign Het
Pdgfrb A T 18: 61,068,757 K464N probably benign Het
Pja2 A T 17: 64,313,030 M1K probably null Het
Pkhd1 A T 1: 20,503,056 N1875K probably damaging Het
Pogz T C 3: 94,880,180 S1360P possibly damaging Het
Proc A T 18: 32,123,459 L385Q probably damaging Het
Ptprm A G 17: 67,095,497 I132T probably benign Het
Rpgr A G X: 10,196,016 S343P probably benign Het
Rsu1 T C 2: 13,170,004 Y225C probably damaging Het
Scyl1 A G 19: 5,770,453 S118P probably damaging Het
Sec61a1 T C 6: 88,506,149 N414D probably benign Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Sema7a A G 9: 57,953,551 D65G probably benign Het
Slc25a45 A G 19: 5,884,436 Y144C probably damaging Het
Slc26a6 A G 9: 108,856,380 Y103C probably damaging Het
Stat3 C T 11: 100,903,674 D270N probably damaging Het
Taar8b T C 10: 24,091,838 S153G probably benign Het
Top1 A G 2: 160,720,965 E697G possibly damaging Het
Trappc11 G A 8: 47,513,766 T470I probably damaging Het
Ttc7b G A 12: 100,500,117 R79C probably damaging Het
Usp29 A G 7: 6,962,480 T441A probably benign Het
Vmn2r110 A T 17: 20,583,767 L182* probably null Het
Zgrf1 T C 3: 127,601,030 I1345T probably benign Het
Zscan25 G T 5: 145,291,005 R493L probably benign Het
Other mutations in Kat2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00473:Kat2b APN 17 53663623 missense possibly damaging 0.46
IGL00793:Kat2b APN 17 53665824 missense probably benign 0.00
IGL01628:Kat2b APN 17 53610897 missense possibly damaging 0.89
IGL02494:Kat2b APN 17 53653205 missense probably damaging 1.00
IGL03347:Kat2b APN 17 53624351 critical splice acceptor site probably null
cakewalk UTSW 17 53638522 missense probably damaging 1.00
fracking UTSW 17 53624422 missense probably damaging 1.00
D605:Kat2b UTSW 17 53629330 missense probably damaging 1.00
R0060:Kat2b UTSW 17 53654543 missense probably damaging 1.00
R0225:Kat2b UTSW 17 53641210 missense probably damaging 1.00
R0372:Kat2b UTSW 17 53638537 missense possibly damaging 0.95
R0638:Kat2b UTSW 17 53644743 splice site probably benign
R0639:Kat2b UTSW 17 53567538 missense probably benign 0.38
R0780:Kat2b UTSW 17 53567448 missense unknown
R1240:Kat2b UTSW 17 53624397 missense probably benign 0.00
R2346:Kat2b UTSW 17 53610904 missense probably benign 0.07
R3402:Kat2b UTSW 17 53665853 missense probably damaging 1.00
R3776:Kat2b UTSW 17 53567581 splice site probably null
R4009:Kat2b UTSW 17 53644741 splice site probably null
R4011:Kat2b UTSW 17 53644741 splice site probably null
R4543:Kat2b UTSW 17 53653140 missense probably benign
R4785:Kat2b UTSW 17 53653203 missense possibly damaging 0.81
R5079:Kat2b UTSW 17 53663638 missense probably damaging 1.00
R5475:Kat2b UTSW 17 53663581 missense probably damaging 1.00
R6993:Kat2b UTSW 17 53638522 missense probably damaging 1.00
R7047:Kat2b UTSW 17 53663569 missense probably benign 0.01
R7058:Kat2b UTSW 17 53665866 missense probably benign 0.00
R7199:Kat2b UTSW 17 53670678 missense probably damaging 1.00
R7276:Kat2b UTSW 17 53624422 missense probably damaging 1.00
R7418:Kat2b UTSW 17 53610925 missense possibly damaging 0.94
R7535:Kat2b UTSW 17 53624403 missense probably damaging 1.00
R7561:Kat2b UTSW 17 53641258 missense probably benign 0.22
R7723:Kat2b UTSW 17 53638387 missense possibly damaging 0.62
R7976:Kat2b UTSW 17 53648807 missense probably benign 0.00
R8250:Kat2b UTSW 17 53663536 missense probably damaging 1.00
R8277:Kat2b UTSW 17 53641253 missense probably benign 0.01
R8969:Kat2b UTSW 17 53660088 nonsense probably null
R9136:Kat2b UTSW 17 53629336 missense probably benign 0.00
R9281:Kat2b UTSW 17 53624397 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ATCAAGAGTGTAGCTTTCTTCCCAC -3'
(R):5'- CAAGTCTCTTCAACACATGATGTAC -3'

Sequencing Primer
(F):5'- CCTTGTCAGCTGCTGAGAG -3'
(R):5'- ACACTGCTGATGTGTGTC -3'
Posted On 2015-09-25