Incidental Mutation 'R4598:Megf10'
ID 345395
Institutional Source Beutler Lab
Gene Symbol Megf10
Ensembl Gene ENSMUSG00000024593
Gene Name multiple EGF-like-domains 10
Synonyms LOC240312, 3000002B06Rik
MMRRC Submission 041814-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.237) question?
Stock # R4598 (G1)
Quality Score 225
Status Not validated
Chromosome 18
Chromosomal Location 57266162-57430539 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 57420884 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Cysteine at position 841 (S841C)
Ref Sequence ENSEMBL: ENSMUSP00000116814 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075770] [ENSMUST00000139892]
AlphaFold Q6DIB5
Predicted Effect probably benign
Transcript: ENSMUST00000075770
AA Change: S841C

PolyPhen 2 Score 0.039 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000075174
Gene: ENSMUSG00000024593
AA Change: S841C

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
EGF 108 136 9.41e-2 SMART
EGF_Lam 152 191 3.57e-2 SMART
EGF 190 222 5.79e-2 SMART
EGF 233 265 1.78e-2 SMART
EGF_Lam 281 320 7.58e-6 SMART
EGF 319 351 7.13e-2 SMART
EGF_Lam 368 409 9.05e-4 SMART
EGF 408 440 8.78e-2 SMART
EGF 451 483 2.85e-1 SMART
EGF 494 526 2.02e-1 SMART
EGF_Lam 542 581 1.04e-3 SMART
EGF 580 612 1.91e-2 SMART
EGF 623 657 2.16e1 SMART
EGF 668 700 2.48e-1 SMART
EGF 711 743 2.81e0 SMART
EGF_Lam 759 798 4.16e-3 SMART
EGF 797 829 1.73e0 SMART
transmembrane domain 856 878 N/A INTRINSIC
low complexity region 1014 1026 N/A INTRINSIC
low complexity region 1131 1146 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000139892
AA Change: S841C

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000116814
Gene: ENSMUSG00000024593
AA Change: S841C

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
EGF 108 136 9.41e-2 SMART
EGF_Lam 152 191 3.57e-2 SMART
EGF 190 222 5.79e-2 SMART
EGF 233 265 1.78e-2 SMART
EGF_Lam 281 320 7.58e-6 SMART
EGF 319 351 7.13e-2 SMART
EGF_Lam 368 409 9.05e-4 SMART
EGF 408 440 8.78e-2 SMART
EGF 451 483 2.85e-1 SMART
EGF 494 526 2.02e-1 SMART
EGF_Lam 542 581 1.04e-3 SMART
EGF 580 612 1.91e-2 SMART
EGF 623 657 2.16e1 SMART
EGF 668 700 2.48e-1 SMART
EGF 711 743 2.81e0 SMART
EGF_Lam 759 798 4.16e-3 SMART
EGF 797 829 1.73e0 SMART
transmembrane domain 856 878 N/A INTRINSIC
low complexity region 1014 1026 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the multiple epidermal growth factor-like domains protein family. The encoded protein plays a role in cell adhesion, motility and proliferation, and is a critical mediator of apoptotic cell phagocytosis as well as amyloid-beta peptide uptake in the brain. Expression of this gene may be associated with schizophrenia, and mutations in this gene are a cause of early-onset myopathy, areflexia, respiratory distress, and dysphagia (EMARDD) as well as congenital myopathy with minicores. Alternatively spliced transcript variants have been observed for this gene. [provided by RefSeq, Apr 2012]
PHENOTYPE: Mice homozygous for a targeted allele exhibit abnormal spacing of starburst amacrine cells and horizontal cells. Homozygotes for another targeted allele exhibit impaired phagocytosis of apoptotic cells by astrocytes. Mice heterozygous for this same allele exhibit mild disorganization of starburts amacrine cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830018L16Rik G A 1: 11,818,188 (GRCm39) probably null Het
Abca14 T C 7: 119,854,626 (GRCm39) V930A probably benign Het
Abcb7 A C X: 103,366,988 (GRCm39) D135E probably benign Het
Ace T A 11: 105,872,585 (GRCm39) probably null Het
Acnat1 T C 4: 49,450,781 (GRCm39) D110G probably benign Het
Ak9 C T 10: 41,259,907 (GRCm39) P862S probably damaging Het
Atp1a3 A G 7: 24,678,766 (GRCm39) S972P probably damaging Het
Bmf C A 2: 118,379,609 (GRCm39) A56S probably benign Het
C6 T C 15: 4,792,852 (GRCm39) L319P possibly damaging Het
Cab39 A G 1: 85,776,050 (GRCm39) Y249C probably damaging Het
Cdc14b T C 13: 64,395,088 (GRCm39) T69A probably benign Het
Cep162 A G 9: 87,085,848 (GRCm39) Y1159H possibly damaging Het
Chrna7 A G 7: 62,753,538 (GRCm39) M327T probably damaging Het
Clca3a2 A T 3: 144,511,444 (GRCm39) N41K probably damaging Het
Clock T C 5: 76,383,657 (GRCm39) M499V probably benign Het
Col5a3 A G 9: 20,685,855 (GRCm39) probably null Het
Coq6 T C 12: 84,408,913 (GRCm39) V30A probably benign Het
Cyp3a57 A G 5: 145,327,227 (GRCm39) I473V probably benign Het
D430041D05Rik A T 2: 104,038,528 (GRCm39) V1547D probably damaging Het
Dhx9 TCC TC 1: 153,342,797 (GRCm39) probably null Het
Dock2 T A 11: 34,189,536 (GRCm39) Y1545F probably damaging Het
Eif4e3 T A 6: 99,617,671 (GRCm39) I67L probably benign Het
Epor A G 9: 21,873,155 (GRCm39) S86P probably benign Het
Esp31 T A 17: 38,952,012 (GRCm39) probably null Het
Esrp2 A G 8: 106,859,343 (GRCm39) M498T probably damaging Het
F5 T C 1: 164,032,366 (GRCm39) I1771T probably benign Het
Fancd2 C A 6: 113,562,438 (GRCm39) H1259Q probably benign Het
Gale C A 4: 135,695,148 (GRCm39) S341* probably null Het
Ints12 T A 3: 132,804,214 (GRCm39) I67N probably benign Het
Kat2b A G 17: 53,977,826 (GRCm39) Y791C probably benign Het
Kazn A G 4: 141,937,403 (GRCm39) V108A possibly damaging Het
Kcnma1 T C 14: 23,853,228 (GRCm39) T109A probably damaging Het
Med13 T C 11: 86,169,392 (GRCm39) T1955A probably damaging Het
Mep1a A G 17: 43,802,469 (GRCm39) probably null Het
Mrap2 A T 9: 87,064,842 (GRCm39) E194D probably damaging Het
Msh2 A G 17: 88,016,006 (GRCm39) K546R probably damaging Het
Ndc80 T C 17: 71,828,063 (GRCm39) D88G probably damaging Het
Nrip1 A G 16: 76,089,968 (GRCm39) F530L probably damaging Het
Or2y10 T C 11: 49,455,545 (GRCm39) S266P probably damaging Het
Or52e7 A C 7: 104,685,280 (GRCm39) I292L probably benign Het
Or6c216 T C 10: 129,678,864 (GRCm39) T16A possibly damaging Het
Or9i16 A T 19: 13,865,381 (GRCm39) H64Q probably damaging Het
Oxtr C T 6: 112,466,713 (GRCm39) G16R probably benign Het
Pdgfrb A T 18: 61,201,829 (GRCm39) K464N probably benign Het
Pja2 A T 17: 64,620,025 (GRCm39) M1K probably null Het
Pkhd1 A T 1: 20,573,280 (GRCm39) N1875K probably damaging Het
Pogz T C 3: 94,787,491 (GRCm39) S1360P possibly damaging Het
Proc A T 18: 32,256,512 (GRCm39) L385Q probably damaging Het
Ptprm A G 17: 67,402,492 (GRCm39) I132T probably benign Het
Rpgr A G X: 10,062,255 (GRCm39) S343P probably benign Het
Rsu1 T C 2: 13,174,815 (GRCm39) Y225C probably damaging Het
Scyl1 A G 19: 5,820,481 (GRCm39) S118P probably damaging Het
Sec61a1 T C 6: 88,483,131 (GRCm39) N414D probably benign Het
Secisbp2l C T 2: 125,582,657 (GRCm39) G933D possibly damaging Het
Sema7a A G 9: 57,860,834 (GRCm39) D65G probably benign Het
Slc25a45 A G 19: 5,934,464 (GRCm39) Y144C probably damaging Het
Slc26a6 A G 9: 108,733,579 (GRCm39) Y103C probably damaging Het
Stat3 C T 11: 100,794,500 (GRCm39) D270N probably damaging Het
Taar8b T C 10: 23,967,736 (GRCm39) S153G probably benign Het
Top1 A G 2: 160,562,885 (GRCm39) E697G possibly damaging Het
Trappc11 G A 8: 47,966,801 (GRCm39) T470I probably damaging Het
Ttc7b G A 12: 100,466,376 (GRCm39) R79C probably damaging Het
Usp29 A G 7: 6,965,479 (GRCm39) T441A probably benign Het
Vmn2r110 A T 17: 20,804,029 (GRCm39) L182* probably null Het
Zgrf1 T C 3: 127,394,679 (GRCm39) I1345T probably benign Het
Zscan25 G T 5: 145,227,815 (GRCm39) R493L probably benign Het
Other mutations in Megf10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00425:Megf10 APN 18 57,373,700 (GRCm39) missense probably damaging 1.00
IGL00736:Megf10 APN 18 57,425,782 (GRCm39) missense probably benign 0.35
IGL01631:Megf10 APN 18 57,392,869 (GRCm39) missense possibly damaging 0.61
IGL02488:Megf10 APN 18 57,425,704 (GRCm39) missense probably damaging 1.00
IGL02747:Megf10 APN 18 57,423,565 (GRCm39) missense probably benign 0.43
IGL03298:Megf10 APN 18 57,416,910 (GRCm39) nonsense probably null
deep UTSW 18 57,395,203 (GRCm39) missense probably damaging 1.00
megalodon UTSW 18 57,421,048 (GRCm39) nonsense probably null
sharkie UTSW 18 57,324,257 (GRCm39) nonsense probably null
IGL03046:Megf10 UTSW 18 57,421,055 (GRCm39) missense possibly damaging 0.95
PIT4696001:Megf10 UTSW 18 57,410,760 (GRCm39) missense probably damaging 1.00
R0020:Megf10 UTSW 18 57,420,965 (GRCm39) missense possibly damaging 0.81
R0020:Megf10 UTSW 18 57,420,965 (GRCm39) missense possibly damaging 0.81
R0115:Megf10 UTSW 18 57,392,874 (GRCm39) missense possibly damaging 0.67
R0455:Megf10 UTSW 18 57,386,054 (GRCm39) missense probably benign 0.34
R0602:Megf10 UTSW 18 57,395,172 (GRCm39) missense probably damaging 0.98
R0630:Megf10 UTSW 18 57,421,067 (GRCm39) missense probably benign 0.14
R0652:Megf10 UTSW 18 57,410,796 (GRCm39) missense probably benign 0.00
R0658:Megf10 UTSW 18 57,385,968 (GRCm39) missense probably benign 0.00
R0761:Megf10 UTSW 18 57,421,048 (GRCm39) nonsense probably null
R1013:Megf10 UTSW 18 57,394,291 (GRCm39) missense probably benign 0.00
R1130:Megf10 UTSW 18 57,395,078 (GRCm39) missense probably benign 0.06
R1451:Megf10 UTSW 18 57,385,931 (GRCm39) missense probably damaging 0.97
R1699:Megf10 UTSW 18 57,410,802 (GRCm39) splice site probably null
R1729:Megf10 UTSW 18 57,373,864 (GRCm39) critical splice donor site probably null
R1784:Megf10 UTSW 18 57,373,864 (GRCm39) critical splice donor site probably null
R1870:Megf10 UTSW 18 57,324,257 (GRCm39) nonsense probably null
R1961:Megf10 UTSW 18 57,345,426 (GRCm39) missense probably damaging 0.97
R2094:Megf10 UTSW 18 57,414,785 (GRCm39) nonsense probably null
R2213:Megf10 UTSW 18 57,421,081 (GRCm39) nonsense probably null
R2853:Megf10 UTSW 18 57,427,003 (GRCm39) missense probably damaging 1.00
R3772:Megf10 UTSW 18 57,416,934 (GRCm39) missense probably benign 0.39
R3774:Megf10 UTSW 18 57,410,177 (GRCm39) missense probably damaging 1.00
R3775:Megf10 UTSW 18 57,410,177 (GRCm39) missense probably damaging 1.00
R3776:Megf10 UTSW 18 57,410,177 (GRCm39) missense probably damaging 1.00
R3858:Megf10 UTSW 18 57,408,907 (GRCm39) splice site probably benign
R3911:Megf10 UTSW 18 57,422,465 (GRCm39) missense probably damaging 0.99
R3966:Megf10 UTSW 18 57,313,646 (GRCm39) missense probably damaging 1.00
R4043:Megf10 UTSW 18 57,392,870 (GRCm39) missense probably damaging 0.98
R4131:Megf10 UTSW 18 57,313,607 (GRCm39) missense probably damaging 1.00
R4598:Megf10 UTSW 18 57,322,675 (GRCm39) critical splice donor site probably null
R4726:Megf10 UTSW 18 57,420,864 (GRCm39) missense probably benign 0.32
R4765:Megf10 UTSW 18 57,420,866 (GRCm39) missense possibly damaging 0.56
R4874:Megf10 UTSW 18 57,426,930 (GRCm39) missense probably benign 0.00
R4928:Megf10 UTSW 18 57,373,745 (GRCm39) missense probably benign
R5412:Megf10 UTSW 18 57,324,219 (GRCm39) missense probably damaging 0.99
R5901:Megf10 UTSW 18 57,410,180 (GRCm39) missense probably benign 0.11
R6015:Megf10 UTSW 18 57,386,100 (GRCm39) missense probably benign 0.01
R6036:Megf10 UTSW 18 57,375,799 (GRCm39) missense probably damaging 1.00
R6036:Megf10 UTSW 18 57,375,799 (GRCm39) missense probably damaging 1.00
R6041:Megf10 UTSW 18 57,313,621 (GRCm39) missense probably benign
R6369:Megf10 UTSW 18 57,394,259 (GRCm39) missense probably benign 0.06
R6479:Megf10 UTSW 18 57,379,642 (GRCm39) missense possibly damaging 0.76
R6489:Megf10 UTSW 18 57,424,879 (GRCm39) missense probably benign 0.01
R7228:Megf10 UTSW 18 57,322,661 (GRCm39) missense probably damaging 1.00
R7296:Megf10 UTSW 18 57,408,825 (GRCm39) missense probably damaging 1.00
R7437:Megf10 UTSW 18 57,395,203 (GRCm39) missense probably damaging 1.00
R7461:Megf10 UTSW 18 57,385,925 (GRCm39) missense probably damaging 0.98
R7488:Megf10 UTSW 18 57,324,187 (GRCm39) missense probably damaging 0.99
R7492:Megf10 UTSW 18 57,424,866 (GRCm39) missense probably benign 0.00
R7542:Megf10 UTSW 18 57,322,642 (GRCm39) missense probably benign 0.07
R7636:Megf10 UTSW 18 57,410,061 (GRCm39) missense possibly damaging 0.85
R7646:Megf10 UTSW 18 57,427,071 (GRCm39) unclassified probably benign
R7650:Megf10 UTSW 18 57,427,071 (GRCm39) unclassified probably benign
R7713:Megf10 UTSW 18 57,427,071 (GRCm39) unclassified probably benign
R7714:Megf10 UTSW 18 57,427,071 (GRCm39) unclassified probably benign
R7716:Megf10 UTSW 18 57,427,071 (GRCm39) unclassified probably benign
R7796:Megf10 UTSW 18 57,410,731 (GRCm39) missense possibly damaging 0.85
R7915:Megf10 UTSW 18 57,373,807 (GRCm39) missense probably benign 0.05
R8221:Megf10 UTSW 18 57,416,893 (GRCm39) missense probably benign 0.00
R8527:Megf10 UTSW 18 57,425,790 (GRCm39) missense probably benign 0.00
R8559:Megf10 UTSW 18 57,373,699 (GRCm39) missense probably damaging 1.00
R9117:Megf10 UTSW 18 57,392,773 (GRCm39) missense probably damaging 1.00
R9337:Megf10 UTSW 18 57,394,252 (GRCm39) nonsense probably null
R9481:Megf10 UTSW 18 57,395,090 (GRCm39) missense probably benign 0.38
R9644:Megf10 UTSW 18 57,375,773 (GRCm39) missense probably benign
RF003:Megf10 UTSW 18 57,427,099 (GRCm39) unclassified probably benign
Z1176:Megf10 UTSW 18 57,410,766 (GRCm39) missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- ACCTTTGAAAGTGGAGAGTGTCTG -3'
(R):5'- ATTGATGACCCTCATGGCGG -3'

Sequencing Primer
(F):5'- GAGAGTGTCTGCTTTCACCATGC -3'
(R):5'- CCTCATGGCGGGGGTGTAG -3'
Posted On 2015-09-25