Incidental Mutation 'R4598:Olfr1504'
ID345399
Institutional Source Beutler Lab
Gene Symbol Olfr1504
Ensembl Gene ENSMUSG00000059105
Gene Nameolfactory receptor 1504
SynonymsMOR212-2, GA_x6K02T2RE5P-4223635-4222688
MMRRC Submission 041814-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.074) question?
Stock #R4598 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location13886920-13897928 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 13888017 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 64 (H64Q)
Ref Sequence ENSEMBL: ENSMUSP00000146610 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078282] [ENSMUST00000209192]
Predicted Effect probably damaging
Transcript: ENSMUST00000078282
AA Change: H64Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000077400
Gene: ENSMUSG00000059105
AA Change: H64Q

DomainStartEndE-ValueType
Pfam:7tm_4 30 307 4.3e-46 PFAM
Pfam:7tm_1 40 313 1.5e-19 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000209192
AA Change: H64Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830018L16Rik G A 1: 11,747,964 probably null Het
Abca14 T C 7: 120,255,403 V930A probably benign Het
Abcb7 A C X: 104,323,382 D135E probably benign Het
Ace T A 11: 105,981,759 probably null Het
Acnat1 T C 4: 49,450,781 D110G probably benign Het
Ak9 C T 10: 41,383,911 P862S probably damaging Het
Atp1a3 A G 7: 24,979,341 S972P probably damaging Het
Bmf C A 2: 118,549,128 A56S probably benign Het
C6 T C 15: 4,763,370 L319P possibly damaging Het
Cab39 A G 1: 85,848,329 Y249C probably damaging Het
Cdc14b T C 13: 64,247,274 T69A probably benign Het
Cep162 A G 9: 87,203,795 Y1159H possibly damaging Het
Chrna7 A G 7: 63,103,790 M327T probably damaging Het
Clca3a2 A T 3: 144,805,683 N41K probably damaging Het
Clock T C 5: 76,235,810 M499V probably benign Het
Col5a3 A G 9: 20,774,559 probably null Het
Coq6 T C 12: 84,362,139 V30A probably benign Het
Cyp3a57 A G 5: 145,390,417 I473V probably benign Het
D430041D05Rik A T 2: 104,208,183 V1547D probably damaging Het
Dhx9 TCC TC 1: 153,467,051 probably null Het
Dock2 T A 11: 34,239,536 Y1545F probably damaging Het
Eif4e3 T A 6: 99,640,710 I67L probably benign Het
Epor A G 9: 21,961,859 S86P probably benign Het
Esp31 T A 17: 38,641,121 probably null Het
Esrp2 A G 8: 106,132,711 M498T probably damaging Het
F5 T C 1: 164,204,797 I1771T probably benign Het
Fancd2 C A 6: 113,585,477 H1259Q probably benign Het
Gale C A 4: 135,967,837 S341* probably null Het
Ints12 T A 3: 133,098,453 I67N probably benign Het
Kat2b A G 17: 53,670,798 Y791C probably benign Het
Kazn A G 4: 142,210,092 V108A possibly damaging Het
Kcnma1 T C 14: 23,803,160 T109A probably damaging Het
Med13 T C 11: 86,278,566 T1955A probably damaging Het
Megf10 G A 18: 57,189,603 probably null Het
Megf10 A T 18: 57,287,812 S841C probably damaging Het
Mep1a A G 17: 43,491,578 probably null Het
Mrap2 A T 9: 87,182,789 E194D probably damaging Het
Msh2 A G 17: 87,708,578 K546R probably damaging Het
Ndc80 T C 17: 71,521,068 D88G probably damaging Het
Nrip1 A G 16: 76,293,080 F530L probably damaging Het
Olfr1380 T C 11: 49,564,718 S266P probably damaging Het
Olfr676 A C 7: 105,036,073 I292L probably benign Het
Olfr812 T C 10: 129,842,995 T16A possibly damaging Het
Oxtr C T 6: 112,489,752 G16R probably benign Het
Pdgfrb A T 18: 61,068,757 K464N probably benign Het
Pja2 A T 17: 64,313,030 M1K probably null Het
Pkhd1 A T 1: 20,503,056 N1875K probably damaging Het
Pogz T C 3: 94,880,180 S1360P possibly damaging Het
Proc A T 18: 32,123,459 L385Q probably damaging Het
Ptprm A G 17: 67,095,497 I132T probably benign Het
Rpgr A G X: 10,196,016 S343P probably benign Het
Rsu1 T C 2: 13,170,004 Y225C probably damaging Het
Scyl1 A G 19: 5,770,453 S118P probably damaging Het
Sec61a1 T C 6: 88,506,149 N414D probably benign Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Sema7a A G 9: 57,953,551 D65G probably benign Het
Slc25a45 A G 19: 5,884,436 Y144C probably damaging Het
Slc26a6 A G 9: 108,856,380 Y103C probably damaging Het
Stat3 C T 11: 100,903,674 D270N probably damaging Het
Taar8b T C 10: 24,091,838 S153G probably benign Het
Top1 A G 2: 160,720,965 E697G possibly damaging Het
Trappc11 G A 8: 47,513,766 T470I probably damaging Het
Ttc7b G A 12: 100,500,117 R79C probably damaging Het
Usp29 A G 7: 6,962,480 T441A probably benign Het
Vmn2r110 A T 17: 20,583,767 L182* probably null Het
Zgrf1 T C 3: 127,601,030 I1345T probably benign Het
Zscan25 G T 5: 145,291,005 R493L probably benign Het
Other mutations in Olfr1504
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Olfr1504 APN 19 13887581 missense probably benign
IGL00885:Olfr1504 APN 19 13888168 missense probably benign 0.17
IGL01084:Olfr1504 APN 19 13887502 missense probably damaging 1.00
IGL01522:Olfr1504 APN 19 13887358 nonsense probably null
IGL01727:Olfr1504 APN 19 13887878 missense probably damaging 0.98
IGL02440:Olfr1504 APN 19 13887859 missense probably damaging 1.00
IGL03342:Olfr1504 APN 19 13887437 missense probably damaging 1.00
R0531:Olfr1504 UTSW 19 13887752 missense possibly damaging 0.62
R0577:Olfr1504 UTSW 19 13887803 missense probably damaging 1.00
R1028:Olfr1504 UTSW 19 13887795 missense probably damaging 0.97
R1674:Olfr1504 UTSW 19 13887590 missense probably benign 0.01
R3906:Olfr1504 UTSW 19 13887706 missense probably damaging 1.00
R4658:Olfr1504 UTSW 19 13887548 missense probably benign 0.19
R4676:Olfr1504 UTSW 19 13887401 missense probably damaging 1.00
R5919:Olfr1504 UTSW 19 13887845 missense probably damaging 1.00
R5943:Olfr1504 UTSW 19 13887752 missense possibly damaging 0.62
Predicted Primers PCR Primer
(F):5'- GTCATGGCCATGGCATAAAGG -3'
(R):5'- GACAATGGCACCAGATTGACAG -3'

Sequencing Primer
(F):5'- GGGGTTACATACAGCCACATAGC -3'
(R):5'- GAATTTATTCTCATGGGATTCCAGC -3'
Posted On2015-09-25