Incidental Mutation 'R0254:Tec'
Institutional Source Beutler Lab
Gene Symbol Tec
Ensembl Gene ENSMUSG00000029217
Gene Nametec protein tyrosine kinase
MMRRC Submission 038485-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.081) question?
Stock #R0254 (G1)
Quality Score182
Status Validated
Chromosomal Location72755716-72868483 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 72783738 bp
Amino Acid Change Proline to Serine at position 159 (P159S)
Ref Sequence ENSEMBL: ENSMUSP00000073509 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071944] [ENSMUST00000073843] [ENSMUST00000113594] [ENSMUST00000126481] [ENSMUST00000138842] [ENSMUST00000149533]
Predicted Effect probably benign
Transcript: ENSMUST00000071944
AA Change: P159S

PolyPhen 2 Score 0.073 (Sensitivity: 0.93; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000071836
Gene: ENSMUSG00000029217
AA Change: P159S

PH 5 113 2.13e-17 SMART
BTK 113 149 1.79e-21 SMART
low complexity region 158 177 N/A INTRINSIC
SH3 181 237 7.06e-17 SMART
SH2 244 335 4.05e-28 SMART
TyrKc 369 618 2.13e-132 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000073843
AA Change: P159S

PolyPhen 2 Score 0.124 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000073509
Gene: ENSMUSG00000029217
AA Change: P159S

PH 5 113 2.13e-17 SMART
BTK 113 149 1.79e-21 SMART
low complexity region 158 177 N/A INTRINSIC
SH3 181 230 2.85e-3 SMART
SH2 222 313 9.96e-28 SMART
TyrKc 347 596 2.13e-132 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113594
AA Change: P159S

PolyPhen 2 Score 0.073 (Sensitivity: 0.93; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000109224
Gene: ENSMUSG00000029217
AA Change: P159S

PH 5 113 2.13e-17 SMART
BTK 113 149 1.79e-21 SMART
low complexity region 158 177 N/A INTRINSIC
SH3 181 237 7.06e-17 SMART
SH2 244 335 4.05e-28 SMART
TyrKc 369 618 2.13e-132 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000126481
AA Change: S164F

PolyPhen 2 Score 0.052 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000123606
Gene: ENSMUSG00000029217
AA Change: S164F

PH 5 113 2.13e-17 SMART
BTK 113 149 1.79e-21 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000138842
SMART Domains Protein: ENSMUSP00000120155
Gene: ENSMUSG00000029217

Pfam:PH 5 98 1.6e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000149533
SMART Domains Protein: ENSMUSP00000123258
Gene: ENSMUSG00000029217

Pfam:PH 5 98 1.6e-10 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000155342
AA Change: S47F
SMART Domains Protein: ENSMUSP00000118980
Gene: ENSMUSG00000029217
AA Change: S47F

BTK 2 33 8.62e-15 SMART
Meta Mutation Damage Score 0.0860 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.1%
  • 20x: 91.7%
Validation Efficiency 100% (100/100)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the Tec family of non-receptor protein-tyrosine kinases containing a pleckstrin homology domain. Tec family kinases are involved in the intracellular signaling mechanisms of cytokine receptors, lymphocyte surface antigens, heterotrimeric G-protein coupled receptors, and integrin molecules. They are also key players in the regulation of the immune functions. Tec kinase is an integral component of T cell signaling and has a distinct role in T cell activation. This gene may be associated with myelodysplastic syndrome. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit a minor reduction in platetet aggregation in response to threshold concentrations of collagen-related peptide or collagen. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 96 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700034J05Rik T A 6: 146,952,404 M252L probably benign Het
Abca6 A G 11: 110,236,789 V314A probably benign Het
Abcb1b A T 5: 8,827,409 E656D probably benign Het
Abhd4 T C 14: 54,263,234 I160T probably benign Het
Aco2 T C 15: 81,889,356 V32A probably damaging Het
Actl6b A G 5: 137,554,144 probably benign Het
Akap13 T C 7: 75,736,604 probably benign Het
Alpk3 A T 7: 81,076,974 T136S probably benign Het
Ap1g1 G T 8: 109,803,117 M56I probably benign Het
Arid2 C T 15: 96,370,571 T855I probably damaging Het
Asprv1 T C 6: 86,629,095 F308L probably damaging Het
Ass1 A T 2: 31,514,819 N371Y probably damaging Het
Atp11b T A 3: 35,812,110 M378K possibly damaging Het
Atp1a3 T C 7: 24,981,512 probably benign Het
Blk C A 14: 63,380,804 A218S probably benign Het
C4b T A 17: 34,734,776 T953S probably benign Het
Cdadc1 T C 14: 59,575,907 probably benign Het
Cdca2 C A 14: 67,677,178 L877F probably damaging Het
Ceacam10 G T 7: 24,778,308 V83L probably damaging Het
Cep290 A T 10: 100,514,574 I677F probably benign Het
Clip1 A T 5: 123,617,332 probably benign Het
Col11a2 G T 17: 34,064,803 probably benign Het
Coro1c A T 5: 113,845,252 V405D probably benign Het
Crebrf A G 17: 26,739,594 T13A probably benign Het
Cspg4 A G 9: 56,897,410 E1835G probably damaging Het
Cubn T C 2: 13,440,514 T1014A possibly damaging Het
Cubn A T 2: 13,476,035 probably null Het
Cubn T C 2: 13,424,694 N1332S probably benign Het
Efnb1 T C X: 99,137,028 probably benign Het
Elf2 G T 3: 51,308,190 P33Q probably damaging Het
Fap C T 2: 62,503,402 G633D probably damaging Het
Gm10288 T C 3: 146,838,920 noncoding transcript Het
Gm14139 G A 2: 150,191,864 R35K possibly damaging Het
Gm7714 A T 5: 88,282,371 H42L possibly damaging Het
Got2 T C 8: 95,869,538 N318S probably benign Het
Guk1 A T 11: 59,186,028 F76L probably damaging Het
H2-K1 A T 17: 33,996,665 probably benign Het
Helz2 C A 2: 181,232,759 G1981C probably damaging Het
Hinfp G A 9: 44,298,239 H250Y probably damaging Het
Hnrnpm C T 17: 33,652,268 probably null Het
Hsd11b2 T A 8: 105,523,067 V270E possibly damaging Het
Igbp1b A T 6: 138,658,203 M81K probably damaging Het
Kif11 A G 19: 37,411,509 T815A probably benign Het
Kit G A 5: 75,620,921 V337I probably benign Het
Klf11 T C 12: 24,653,583 S6P probably damaging Het
Klk13 T C 7: 43,723,821 V193A probably benign Het
Krt73 T A 15: 101,799,889 probably benign Het
L1td1 T A 4: 98,737,182 L538* probably null Het
Macf1 A G 4: 123,432,779 L2061P probably damaging Het
Mcm2 A G 6: 88,884,016 I900T probably damaging Het
Med16 A T 10: 79,900,200 N371K possibly damaging Het
Mepce A C 5: 137,785,436 D209E possibly damaging Het
Mrc2 C G 11: 105,347,866 P1249R probably benign Het
Mx2 A T 16: 97,556,095 I463L probably benign Het
Naaa A T 5: 92,265,135 N73K probably damaging Het
Nags T A 11: 102,147,945 L404Q probably damaging Het
Neb A G 2: 52,243,390 Y3379H probably damaging Het
Nhsl1 A G 10: 18,472,985 E120G probably damaging Het
Olfr1276 A C 2: 111,257,121 N2T probably benign Het
Olfr561 C A 7: 102,774,869 S115* probably null Het
Olfr615 T A 7: 103,560,622 Y48* probably null Het
Olfr643 T C 7: 104,059,521 H27R probably benign Het
Olfr736 T C 14: 50,393,079 S108P probably damaging Het
Pcnt A G 10: 76,392,580 F1584L probably benign Het
Pdgfra G A 5: 75,167,935 V243I probably damaging Het
Polr2a T C 11: 69,743,671 I689V possibly damaging Het
Ppfia4 C A 1: 134,324,224 probably benign Het
Prmt8 C A 6: 127,711,808 V200L probably damaging Het
Prpf8 T A 11: 75,506,362 I2007N possibly damaging Het
Ptpn6 T C 6: 124,728,150 E230G probably damaging Het
R3hcc1l G A 19: 42,563,148 V195I probably damaging Het
Rb1cc1 C T 1: 6,262,847 T1330I probably damaging Het
Reep3 G T 10: 67,021,796 T172N probably benign Het
Rfwd3 A G 8: 111,294,023 V236A probably benign Het
Rgs22 T C 15: 36,104,552 I121V probably damaging Het
Robo1 T A 16: 72,664,170 F11I probably benign Het
Rsrc2 A G 5: 123,740,847 probably benign Het
Rubcn A G 16: 32,847,946 V117A probably benign Het
Scamp1 T G 13: 94,210,580 N192T probably benign Het
Scn8a T A 15: 101,018,364 I1218N probably damaging Het
Serinc1 A G 10: 57,523,208 S200P probably damaging Het
Serpinb9f T A 13: 33,334,591 F358Y probably damaging Het
Slc12a5 T C 2: 164,997,245 probably null Het
Slc5a4b T C 10: 76,070,628 M386V possibly damaging Het
Smarca5 A G 8: 80,704,700 F963L probably benign Het
Smchd1 A T 17: 71,411,891 F828I probably benign Het
Stab2 G T 10: 86,897,960 Q1333K probably benign Het
Svop T C 5: 114,038,539 S349G probably benign Het
Tdrd1 G A 19: 56,842,566 S271N probably benign Het
Tfip11 G A 5: 112,335,655 M645I probably benign Het
Thap12 A T 7: 98,715,281 T219S probably benign Het
Tmem87a C T 2: 120,375,507 R329H probably damaging Het
Tpsab1 A G 17: 25,343,745 Y227H probably damaging Het
Urah G A 7: 140,837,689 V114I probably benign Het
Wnt5a G A 14: 28,522,854 E353K probably damaging Het
Zfp101 A T 17: 33,380,978 H601Q possibly damaging Het
Other mutations in Tec
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00230:Tec APN 5 72768768 missense probably damaging 1.00
IGL00980:Tec APN 5 72786798 missense probably damaging 1.00
IGL01986:Tec APN 5 72782005 nonsense probably null
IGL02505:Tec APN 5 72789244 missense probably damaging 1.00
IGL02522:Tec APN 5 72789172 missense probably benign 0.01
IGL02527:Tec APN 5 72779415 splice site probably null
IGL03292:Tec APN 5 72757364 missense probably null 0.98
development UTSW 5 72782177 critical splice acceptor site probably null
technocrat UTSW 5 72782012 missense probably null 0.98
IGL02988:Tec UTSW 5 72768747 missense possibly damaging 0.95
PIT4696001:Tec UTSW 5 72773835 missense possibly damaging 0.73
R0254:Tec UTSW 5 72763556 splice site probably benign
R0646:Tec UTSW 5 72823497 missense probably damaging 1.00
R1122:Tec UTSW 5 72779449 missense probably damaging 0.96
R1495:Tec UTSW 5 72786755 missense probably damaging 1.00
R1617:Tec UTSW 5 72782105 missense probably damaging 0.97
R3905:Tec UTSW 5 72760362 missense probably damaging 1.00
R3953:Tec UTSW 5 72782177 critical splice acceptor site probably null
R3954:Tec UTSW 5 72782177 critical splice acceptor site probably null
R3955:Tec UTSW 5 72782177 critical splice acceptor site probably null
R3981:Tec UTSW 5 72823599 utr 5 prime probably benign
R4061:Tec UTSW 5 72823409 unclassified probably benign
R4389:Tec UTSW 5 72782007 missense probably benign
R4507:Tec UTSW 5 72760358 missense probably damaging 1.00
R4689:Tec UTSW 5 72823637 start gained probably benign
R4702:Tec UTSW 5 72783731 missense possibly damaging 0.71
R4776:Tec UTSW 5 72768776 missense probably benign 0.38
R4911:Tec UTSW 5 72756351 missense probably benign 0.05
R4923:Tec UTSW 5 72782022 nonsense probably null
R4932:Tec UTSW 5 72760393 nonsense probably null
R5595:Tec UTSW 5 72768744 missense possibly damaging 0.91
R7211:Tec UTSW 5 72782012 missense probably null 0.98
R7404:Tec UTSW 5 72763618 missense probably damaging 1.00
R7465:Tec UTSW 5 72773880 missense probably damaging 1.00
R7526:Tec UTSW 5 72786019 missense probably benign
R7548:Tec UTSW 5 72760350 missense probably damaging 1.00
R7699:Tec UTSW 5 72786024 missense possibly damaging 0.60
R7700:Tec UTSW 5 72786024 missense possibly damaging 0.60
R8021:Tec UTSW 5 72757469 missense probably benign 0.03
R8217:Tec UTSW 5 72764259 missense probably benign 0.13
R8704:Tec UTSW 5 72768762 missense probably damaging 1.00
Z1177:Tec UTSW 5 72768707 missense probably damaging 1.00
Z1177:Tec UTSW 5 72782015 missense possibly damaging 0.90
Predicted Primers PCR Primer

Sequencing Primer
(F):5'- ttgtctgtctgtccttcatcc -3'
Posted On2013-05-09