Mutagenetix > Incidental Mutation

Incidental Mutation 'R4599:Med27'

345407

Institutional Source

Beutler Lab

Gene Symbol

Med27

Ensembl Gene

ENSMUSG00000026799

Gene Name

mediator complex subunit 27

Synonyms

D2Ertd434e, Crsp8, 1500015J03Rik, 2310042P07Rik

MMRRC Submission

041815-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.952) question?

Stock #

R4599 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

29346819-29524793 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 29524458 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 159 (D159G)

Ref Sequence

ENSEMBL: ENSMUSP00000125390 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028139] [ENSMUST00000159280]

AlphaFold

Q9DB40

Predicted Effect

probably damaging
Transcript: ENSMUST00000028139
AA Change: D298G

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000028139
Gene: ENSMUSG00000026799
AA Change: D298G

Domain	Start	End	E-Value	Type
Pfam:Med27	228	310	7.2e-30	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000123522

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000147547

Predicted Effect

probably damaging
Transcript: ENSMUST00000159280
AA Change: D159G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000125390
Gene: ENSMUSG00000026799
AA Change: D159G

Domain	Start	End	E-Value	Type
Pfam:Med27	85	171	1.4e-29	PFAM

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The activation of gene transcription is a multistep process that is triggered by factors that recognize transcriptional enhancer sites in DNA. These factors work with co-activators to direct transcriptional initiation by the RNA polymerase II apparatus. The protein encoded by this gene is a subunit of the CRSP (cofactor required for SP1 activation) complex, which, along with TFIID, is required for efficient activation by SP1. This protein is also a component of other multisubunit complexes e.g. thyroid hormone receptor-(TR-) associated proteins which interact with TR and facilitate TR function on DNA templates in conjunction with initiation factors and cofactors. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene, and a pseudogene of this gene is located on the long arm of chromosome 5. [provided by RefSeq, Dec 2011]

Allele List at MGI

Other mutations in this stock

Total: 69 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca14	T	C	7: 120,255,403	V930A	probably benign	Het
Ankrd13b	T	C	11: 77,471,668	R677G	probably benign	Het
Apc	T	A	18: 34,317,987	Y2611*	probably null	Het
Apold1	A	G	6: 134,984,069	Y162C	probably damaging	Het
Atp6v0a4	T	C	6: 38,078,802	I325V	probably benign	Het
Cab39	A	G	1: 85,848,329	Y249C	probably damaging	Het
Cd22	T	A	7: 30,875,900	H239L	probably damaging	Het
Chrna7	A	G	7: 63,103,790	M327T	probably damaging	Het
Clock	T	C	5: 76,235,810	M499V	probably benign	Het
Clspn	A	G	4: 126,581,460	E1002G	probably benign	Het
Clta	C	T	4: 44,012,819	P10S	probably damaging	Het
Col5a3	A	G	9: 20,774,559		probably null	Het
Coq6	T	C	12: 84,362,139	V30A	probably benign	Het
Csmd2	G	T	4: 127,988,128	R20L	probably benign	Het
D430041D05Rik	A	T	2: 104,208,183	V1547D	probably damaging	Het
Dapk1	C	T	13: 60,718,047	P153S	probably benign	Het
Dock2	T	A	11: 34,239,536	Y1545F	probably damaging	Het
Dpp6	G	T	5: 27,634,548	G354C	probably damaging	Het
Dyrk1b	T	C	7: 28,182,431	L105P	probably damaging	Het
Epor	A	G	9: 21,961,859	S86P	probably benign	Het
Fam166b	T	C	4: 43,427,574	H250R	possibly damaging	Het
Gale	C	A	4: 135,967,837	S341*	probably null	Het
Galnt4	T	A	10: 99,109,493	V360E	probably damaging	Het
Gart	A	T	16: 91,622,945	C24*	probably null	Het
Gcnt2	G	T	13: 40,887,490	V42L	probably benign	Het
Herc6	A	G	6: 57,659,713	I805V	probably benign	Het
Ints12	T	A	3: 133,098,453	I67N	probably benign	Het
Irx1	C	A	13: 71,960,113	R150L	probably damaging	Het
Kif26b	A	G	1: 178,530,459	Y45C	unknown	Het
Krt35	T	C	11: 100,094,008	T275A	probably damaging	Het
Laptm5	G	T	4: 130,916,005		probably benign	Het
Lin7a	T	C	10: 107,412,166	S111P	unknown	Het
Msh2	A	G	17: 87,708,578	K546R	probably damaging	Het
Myo1a	A	T	10: 127,720,151		probably null	Het
Myo1c	T	C	11: 75,668,193	F604L	probably damaging	Het
Myrip	A	G	9: 120,464,784	K782E	probably damaging	Het
Ndc80	T	C	17: 71,521,068	D88G	probably damaging	Het
Nrxn2	A	G	19: 6,455,252	D375G	probably damaging	Het
Olfr1380	T	C	11: 49,564,718	S266P	probably damaging	Het
Olfr676	A	G	7: 105,036,073	I292V	probably benign	Het
Padi3	T	C	4: 140,798,111	H187R	probably damaging	Het
Pcdhgb1	A	T	18: 37,681,557	N367I	probably damaging	Het
Pdrg1	T	C	2: 153,012,390	I77V	probably benign	Het
Pfas	T	C	11: 68,991,069	E930G	probably benign	Het
Pik3cb	C	T	9: 99,061,764	R662Q	probably benign	Het
Pla2g4e	T	G	2: 120,186,382	H226P	possibly damaging	Het
Plxnd1	A	T	6: 115,994,276	V177E	probably damaging	Het
Prmt7	A	G	8: 106,250,329	S558G	possibly damaging	Het
Pspc1	A	C	14: 56,777,789		probably null	Het
Rilp	T	C	11: 75,512,760	S343P	probably benign	Het
Ror1	A	G	4: 100,407,910	M194V	probably damaging	Het
Rsu1	T	C	2: 13,170,004	Y225C	probably damaging	Het
Rundc1	A	G	11: 101,433,926	N486S	probably damaging	Het
Sema6d	T	A	2: 124,654,231	I65N	probably damaging	Het
Slc5a11	A	G	7: 123,258,378	E230G	probably benign	Het
Spint1	T	C	2: 119,246,460	S342P	probably damaging	Het
Stard3nl	A	G	13: 19,367,753	S214P	probably damaging	Het
Tcp10a	A	C	17: 7,336,924	T271P	probably damaging	Het
Tie1	A	G	4: 118,472,634	Y1091H	probably benign	Het
Tlr12	T	C	4: 128,617,332	Y375C	probably benign	Het
Tmem107	T	A	11: 69,071,448	M77K	probably damaging	Het
Tns2	C	T	15: 102,108,934	R281C	probably damaging	Het
Tns3	T	C	11: 8,531,747	K202E	probably damaging	Het
Tspoap1	C	T	11: 87,779,521	P1634L	probably damaging	Het
Ttc7b	G	A	12: 100,500,117	R79C	probably damaging	Het
Ush2a	A	G	1: 188,911,647	N4402S	probably benign	Het
Vmn2r13	A	T	5: 109,156,456	I703N	probably damaging	Het
Xrcc4	A	G	13: 90,062,007		probably null	Het
Zp3	A	T	5: 135,984,235	K168*	probably null	Het

Other mutations in Med27

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01886:Med27	APN	2	29413482	missense	probably damaging	1.00
R0427:Med27	UTSW	2	29500271	missense	probably damaging	1.00
R1769:Med27	UTSW	2	29500295	missense	probably damaging	0.99
R2126:Med27	UTSW	2	29524430	nonsense	probably null
R3196:Med27	UTSW	2	29346870	missense	possibly damaging	0.86
R4093:Med27	UTSW	2	29377908	unclassified	probably benign
R4498:Med27	UTSW	2	29471342	missense	probably damaging	0.99
R4722:Med27	UTSW	2	29524435	missense	probably damaging	0.98
R4771:Med27	UTSW	2	29413503	missense	probably damaging	1.00
R4828:Med27	UTSW	2	29377938	unclassified	probably benign
R5870:Med27	UTSW	2	29389811	critical splice acceptor site	probably null
R6061:Med27	UTSW	2	29509441	missense	probably damaging	0.99
R6159:Med27	UTSW	2	29524364	splice site	probably null
R7028:Med27	UTSW	2	29509434	nonsense	probably null
R7319:Med27	UTSW	2	29413478	missense	possibly damaging	0.53
R7387:Med27	UTSW	2	29413407	missense	possibly damaging	0.96
R7671:Med27	UTSW	2	29377938	missense
R8255:Med27	UTSW	2	29524364	splice site	probably null
R8969:Med27	UTSW	2	29346863	missense	possibly damaging	0.86
R9026:Med27	UTSW	2	29509434	nonsense	probably null
R9194:Med27	UTSW	2	29471300	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- GGCAGCTTTCCTATAGGACC -3'
(R):5'- ATGCCCCATCATGACATGC -3'

Sequencing Primer
(F):5'- CAGCTTTCCTATAGGACCATGGG -3'
(R):5'- TGACATGCAGCTGACAGTTC -3'

Posted On

2015-09-25