Mutagenetix > Incidental Mutation

Incidental Mutation 'R4599:Pla2g4e'

345411

Institutional Source

Beutler Lab

Gene Symbol

Pla2g4e

Ensembl Gene

ENSMUSG00000050211

Gene Name

phospholipase A2, group IVE

Synonyms

Pla2epsilon, 2310026J01Rik

MMRRC Submission

041815-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4599 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

120166412-120245335 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 120186382 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Proline at position 226 (H226P)

Ref Sequence

ENSEMBL: ENSMUSP00000087525 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000090071]

AlphaFold

Q50L42

Predicted Effect

possibly damaging
Transcript: ENSMUST00000090071
AA Change: H226P

PolyPhen 2 Score 0.528 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000087525
Gene: ENSMUSG00000050211
AA Change: H226P

Domain	Start	End	E-Value	Type
low complexity region	61	73	N/A	INTRINSIC
C2	82	182	3.42e-14	SMART
low complexity region	191	207	N/A	INTRINSIC
PLAc	311	818	5.17e-13	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000127009

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000136845

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000152263

Meta Mutation Damage Score

0.0985

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cytosolic phospholipase A2 group IV family. Members of this family are involved in regulation of membrane tubule-mediated transport. The enzyme encoded by this member of the family plays a role in trafficking through the clathrin-independent endocytic pathway. The enzyme regulates the recycling process via formation of tubules that transport internalized clathrin-independent cargo proteins back to the cell surface. [provided by RefSeq, Jan 2017]

Allele List at MGI

Other mutations in this stock

Total: 69 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca14	T	C	7: 120,255,403	V930A	probably benign	Het
Ankrd13b	T	C	11: 77,471,668	R677G	probably benign	Het
Apc	T	A	18: 34,317,987	Y2611*	probably null	Het
Apold1	A	G	6: 134,984,069	Y162C	probably damaging	Het
Atp6v0a4	T	C	6: 38,078,802	I325V	probably benign	Het
Cab39	A	G	1: 85,848,329	Y249C	probably damaging	Het
Cd22	T	A	7: 30,875,900	H239L	probably damaging	Het
Chrna7	A	G	7: 63,103,790	M327T	probably damaging	Het
Clock	T	C	5: 76,235,810	M499V	probably benign	Het
Clspn	A	G	4: 126,581,460	E1002G	probably benign	Het
Clta	C	T	4: 44,012,819	P10S	probably damaging	Het
Col5a3	A	G	9: 20,774,559		probably null	Het
Coq6	T	C	12: 84,362,139	V30A	probably benign	Het
Csmd2	G	T	4: 127,988,128	R20L	probably benign	Het
D430041D05Rik	A	T	2: 104,208,183	V1547D	probably damaging	Het
Dapk1	C	T	13: 60,718,047	P153S	probably benign	Het
Dock2	T	A	11: 34,239,536	Y1545F	probably damaging	Het
Dpp6	G	T	5: 27,634,548	G354C	probably damaging	Het
Dyrk1b	T	C	7: 28,182,431	L105P	probably damaging	Het
Epor	A	G	9: 21,961,859	S86P	probably benign	Het
Fam166b	T	C	4: 43,427,574	H250R	possibly damaging	Het
Gale	C	A	4: 135,967,837	S341*	probably null	Het
Galnt4	T	A	10: 99,109,493	V360E	probably damaging	Het
Gart	A	T	16: 91,622,945	C24*	probably null	Het
Gcnt2	G	T	13: 40,887,490	V42L	probably benign	Het
Herc6	A	G	6: 57,659,713	I805V	probably benign	Het
Ints12	T	A	3: 133,098,453	I67N	probably benign	Het
Irx1	C	A	13: 71,960,113	R150L	probably damaging	Het
Kif26b	A	G	1: 178,530,459	Y45C	unknown	Het
Krt35	T	C	11: 100,094,008	T275A	probably damaging	Het
Laptm5	G	T	4: 130,916,005		probably benign	Het
Lin7a	T	C	10: 107,412,166	S111P	unknown	Het
Med27	A	G	2: 29,524,458	D159G	probably damaging	Het
Msh2	A	G	17: 87,708,578	K546R	probably damaging	Het
Myo1a	A	T	10: 127,720,151		probably null	Het
Myo1c	T	C	11: 75,668,193	F604L	probably damaging	Het
Myrip	A	G	9: 120,464,784	K782E	probably damaging	Het
Ndc80	T	C	17: 71,521,068	D88G	probably damaging	Het
Nrxn2	A	G	19: 6,455,252	D375G	probably damaging	Het
Olfr1380	T	C	11: 49,564,718	S266P	probably damaging	Het
Olfr676	A	G	7: 105,036,073	I292V	probably benign	Het
Padi3	T	C	4: 140,798,111	H187R	probably damaging	Het
Pcdhgb1	A	T	18: 37,681,557	N367I	probably damaging	Het
Pdrg1	T	C	2: 153,012,390	I77V	probably benign	Het
Pfas	T	C	11: 68,991,069	E930G	probably benign	Het
Pik3cb	C	T	9: 99,061,764	R662Q	probably benign	Het
Plxnd1	A	T	6: 115,994,276	V177E	probably damaging	Het
Prmt7	A	G	8: 106,250,329	S558G	possibly damaging	Het
Pspc1	A	C	14: 56,777,789		probably null	Het
Rilp	T	C	11: 75,512,760	S343P	probably benign	Het
Ror1	A	G	4: 100,407,910	M194V	probably damaging	Het
Rsu1	T	C	2: 13,170,004	Y225C	probably damaging	Het
Rundc1	A	G	11: 101,433,926	N486S	probably damaging	Het
Sema6d	T	A	2: 124,654,231	I65N	probably damaging	Het
Slc5a11	A	G	7: 123,258,378	E230G	probably benign	Het
Spint1	T	C	2: 119,246,460	S342P	probably damaging	Het
Stard3nl	A	G	13: 19,367,753	S214P	probably damaging	Het
Tcp10a	A	C	17: 7,336,924	T271P	probably damaging	Het
Tie1	A	G	4: 118,472,634	Y1091H	probably benign	Het
Tlr12	T	C	4: 128,617,332	Y375C	probably benign	Het
Tmem107	T	A	11: 69,071,448	M77K	probably damaging	Het
Tns2	C	T	15: 102,108,934	R281C	probably damaging	Het
Tns3	T	C	11: 8,531,747	K202E	probably damaging	Het
Tspoap1	C	T	11: 87,779,521	P1634L	probably damaging	Het
Ttc7b	G	A	12: 100,500,117	R79C	probably damaging	Het
Ush2a	A	G	1: 188,911,647	N4402S	probably benign	Het
Vmn2r13	A	T	5: 109,156,456	I703N	probably damaging	Het
Xrcc4	A	G	13: 90,062,007		probably null	Het
Zp3	A	T	5: 135,984,235	K168*	probably null	Het

Other mutations in Pla2g4e

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00470:Pla2g4e	APN	2	120185238	missense	probably benign
IGL01712:Pla2g4e	APN	2	120189403	critical splice donor site	probably null
IGL01859:Pla2g4e	APN	2	120182733	missense	possibly damaging	0.70
IGL02334:Pla2g4e	APN	2	120187236	missense	probably benign
FR4737:Pla2g4e	UTSW	2	120244724	small deletion	probably benign
R0157:Pla2g4e	UTSW	2	120170181	missense	probably benign	0.00
R0578:Pla2g4e	UTSW	2	120244681	splice site	probably benign
R0675:Pla2g4e	UTSW	2	120200198	splice site	probably benign
R1278:Pla2g4e	UTSW	2	120168470	critical splice donor site	probably null
R1346:Pla2g4e	UTSW	2	120182772	missense	probably damaging	1.00
R1760:Pla2g4e	UTSW	2	120170046	missense	possibly damaging	0.50
R1773:Pla2g4e	UTSW	2	120244721	missense	probably benign
R1792:Pla2g4e	UTSW	2	120168474	missense	probably damaging	1.00
R2129:Pla2g4e	UTSW	2	120182811	missense	probably damaging	0.99
R2160:Pla2g4e	UTSW	2	120185206	missense	probably benign	0.00
R2191:Pla2g4e	UTSW	2	120191199	frame shift	probably null
R3901:Pla2g4e	UTSW	2	120168604	missense	probably benign	0.00
R4342:Pla2g4e	UTSW	2	120186446	intron	probably benign
R4414:Pla2g4e	UTSW	2	120182713	missense	probably benign
R4460:Pla2g4e	UTSW	2	120186382	missense	possibly damaging	0.53
R4581:Pla2g4e	UTSW	2	120186382	missense	possibly damaging	0.53
R4601:Pla2g4e	UTSW	2	120186382	missense	possibly damaging	0.53
R4610:Pla2g4e	UTSW	2	120186382	missense	possibly damaging	0.53
R4611:Pla2g4e	UTSW	2	120186382	missense	possibly damaging	0.53
R4664:Pla2g4e	UTSW	2	120171188	missense	probably damaging	0.97
R4688:Pla2g4e	UTSW	2	120167933	missense	possibly damaging	0.82
R4691:Pla2g4e	UTSW	2	120174300	missense	probably damaging	1.00
R4944:Pla2g4e	UTSW	2	120171237	missense	probably benign	0.01
R5051:Pla2g4e	UTSW	2	120174304	missense	probably damaging	1.00
R5285:Pla2g4e	UTSW	2	120189504	missense	probably damaging	1.00
R5373:Pla2g4e	UTSW	2	120186395	missense	probably benign	0.30
R5374:Pla2g4e	UTSW	2	120186395	missense	probably benign	0.30
R5505:Pla2g4e	UTSW	2	120244775	missense	probably benign	0.08
R5702:Pla2g4e	UTSW	2	120188511	missense	possibly damaging	0.61
R6300:Pla2g4e	UTSW	2	120182738	missense	probably benign	0.00
R6711:Pla2g4e	UTSW	2	120171270	missense	probably benign	0.00
R6920:Pla2g4e	UTSW	2	120185314	missense	possibly damaging	0.82
R6961:Pla2g4e	UTSW	2	120174370	splice site	probably null
R6987:Pla2g4e	UTSW	2	120186380	missense	probably benign	0.01
R7028:Pla2g4e	UTSW	2	120170195	missense	probably damaging	1.00
R7138:Pla2g4e	UTSW	2	120171278	missense	probably damaging	1.00
R7300:Pla2g4e	UTSW	2	120191199	missense	probably damaging	1.00
R7355:Pla2g4e	UTSW	2	120181501	missense	possibly damaging	0.91
R7502:Pla2g4e	UTSW	2	120174338	splice site	probably null
R7849:Pla2g4e	UTSW	2	120185322	missense	probably benign	0.32
R8288:Pla2g4e	UTSW	2	120188509	critical splice donor site	probably null
R8686:Pla2g4e	UTSW	2	120244691	missense	probably damaging	0.98
R9003:Pla2g4e	UTSW	2	120176801	missense	probably benign	0.03
R9023:Pla2g4e	UTSW	2	120171237	missense	probably benign	0.01
R9261:Pla2g4e	UTSW	2	120189429	missense	probably benign	0.04
R9284:Pla2g4e	UTSW	2	120174249	splice site	probably benign
R9299:Pla2g4e	UTSW	2	120171723	missense	probably damaging	1.00
R9338:Pla2g4e	UTSW	2	120189433	missense	probably benign	0.07
R9555:Pla2g4e	UTSW	2	120244919	start gained	probably benign
R9604:Pla2g4e	UTSW	2	120185199	missense	probably benign	0.02
RF044:Pla2g4e	UTSW	2	120244724	small deletion	probably benign
Z1177:Pla2g4e	UTSW	2	120181523	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- TGGATCCCTGGAAGAACAAACC -3'
(R):5'- ATTGTCTACACCAAGCCCAG -3'

Sequencing Primer
(F):5'- GACGTCTGAAGACACGATTTTG -3'
(R):5'- TGAACTTAGAGTCCCAGC -3'

Posted On

2015-09-25