Incidental Mutation 'R4599:Sema6d'
ID 345412
Institutional Source Beutler Lab
Gene Symbol Sema6d
Ensembl Gene ENSMUSG00000027200
Gene Name sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6D
Synonyms Sema6D-6, 1110067B02Rik, Sema6D-1, Sema6D-4, Sema6D-5, Sema6D-2
MMRRC Submission 041815-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4599 (G1)
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 123931889-124509690 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 124496151 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 65 (I65N)
Ref Sequence ENSEMBL: ENSMUSP00000099530 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051419] [ENSMUST00000076335] [ENSMUST00000077847] [ENSMUST00000078621] [ENSMUST00000103238] [ENSMUST00000103239] [ENSMUST00000103240] [ENSMUST00000103241]
AlphaFold Q76KF0
Predicted Effect probably damaging
Transcript: ENSMUST00000051419
AA Change: I65N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000061123
Gene: ENSMUSG00000027200
AA Change: I65N

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Sema 57 487 7.29e-184 SMART
PSI 514 582 4.57e-1 SMART
transmembrane domain 602 624 N/A INTRINSIC
low complexity region 743 764 N/A INTRINSIC
internal_repeat_1 797 898 7.43e-5 PROSPERO
internal_repeat_1 892 1004 7.43e-5 PROSPERO
Predicted Effect probably damaging
Transcript: ENSMUST00000076335
AA Change: I65N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000075674
Gene: ENSMUSG00000027200
AA Change: I65N

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Sema 57 487 7.29e-184 SMART
PSI 514 569 1.12e-1 SMART
transmembrane domain 589 611 N/A INTRINSIC
low complexity region 730 751 N/A INTRINSIC
internal_repeat_1 784 885 7.28e-5 PROSPERO
internal_repeat_1 879 991 7.28e-5 PROSPERO
Predicted Effect probably damaging
Transcript: ENSMUST00000077847
AA Change: I65N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000077014
Gene: ENSMUSG00000027200
AA Change: I65N

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Sema 57 487 7.29e-184 SMART
PSI 514 569 1.12e-1 SMART
low complexity region 573 584 N/A INTRINSIC
transmembrane domain 645 667 N/A INTRINSIC
low complexity region 786 807 N/A INTRINSIC
internal_repeat_1 840 941 5.95e-5 PROSPERO
internal_repeat_1 935 1047 5.95e-5 PROSPERO
Predicted Effect probably damaging
Transcript: ENSMUST00000078621
AA Change: I65N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000077691
Gene: ENSMUSG00000027200
AA Change: I65N

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Sema 57 487 7.29e-184 SMART
PSI 514 582 4.57e-1 SMART
transmembrane domain 621 643 N/A INTRINSIC
low complexity region 762 783 N/A INTRINSIC
internal_repeat_1 816 917 8.83e-5 PROSPERO
internal_repeat_1 911 1023 8.83e-5 PROSPERO
Predicted Effect probably damaging
Transcript: ENSMUST00000103238
AA Change: I65N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000099528
Gene: ENSMUSG00000027200
AA Change: I65N

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Sema 57 487 7.29e-184 SMART
PSI 514 569 1.12e-1 SMART
low complexity region 573 584 N/A INTRINSIC
transmembrane domain 645 667 N/A INTRINSIC
low complexity region 786 807 N/A INTRINSIC
internal_repeat_1 840 941 5.95e-5 PROSPERO
internal_repeat_1 935 1047 5.95e-5 PROSPERO
Predicted Effect probably damaging
Transcript: ENSMUST00000103239
AA Change: I65N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000099529
Gene: ENSMUSG00000027200
AA Change: I65N

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Sema 57 487 7.29e-184 SMART
PSI 514 569 1.12e-1 SMART
low complexity region 587 603 N/A INTRINSIC
transmembrane domain 664 686 N/A INTRINSIC
low complexity region 805 826 N/A INTRINSIC
internal_repeat_1 859 960 5.78e-5 PROSPERO
internal_repeat_1 954 1066 5.78e-5 PROSPERO
Predicted Effect probably damaging
Transcript: ENSMUST00000103240
AA Change: I65N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099530
Gene: ENSMUSG00000027200
AA Change: I65N

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Sema 57 487 7.29e-184 SMART
PSI 514 569 1.12e-1 SMART
low complexity region 587 603 N/A INTRINSIC
transmembrane domain 660 682 N/A INTRINSIC
low complexity region 801 822 N/A INTRINSIC
internal_repeat_1 855 956 5.63e-5 PROSPERO
internal_repeat_1 950 1062 5.63e-5 PROSPERO
Predicted Effect probably damaging
Transcript: ENSMUST00000103241
AA Change: I65N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000099531
Gene: ENSMUSG00000027200
AA Change: I65N

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Sema 57 487 7.29e-184 SMART
PSI 514 569 1.12e-1 SMART
transmembrane domain 589 611 N/A INTRINSIC
low complexity region 730 751 N/A INTRINSIC
internal_repeat_1 784 885 7.28e-5 PROSPERO
internal_repeat_1 879 991 7.28e-5 PROSPERO
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132088
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Semaphorins are a large family, including both secreted and membrane associated proteins, many of which have been implicated as inhibitors or chemorepellents in axon pathfinding, fasciculation and branching, and target selection. All semaphorins possess a semaphorin (Sema) domain and a PSI domain (found in plexins, semaphorins and integrins) in the N-terminal extracellular portion. Additional sequence motifs C-terminal to the semaphorin domain allow classification into distinct subfamilies. Results demonstrate that transmembrane semaphorins, like the secreted ones, can act as repulsive axon guidance cues. This gene encodes a class 6 vertebrate transmembrane semaphorin that demonstrates alternative splicing. Several transcript variants have been identified and expression of the distinct encoded isoforms is thought to be regulated in a tissue- and development-dependent manner. [provided by RefSeq, Nov 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal dendritic cell trafficking and antigen-specific T cell priming. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 T C 7: 119,854,626 (GRCm39) V930A probably benign Het
Ankrd13b T C 11: 77,362,494 (GRCm39) R677G probably benign Het
Apc T A 18: 34,451,040 (GRCm39) Y2611* probably null Het
Apold1 A G 6: 134,961,032 (GRCm39) Y162C probably damaging Het
Atp6v0a4 T C 6: 38,055,737 (GRCm39) I325V probably benign Het
Cab39 A G 1: 85,776,050 (GRCm39) Y249C probably damaging Het
Cd22 T A 7: 30,575,325 (GRCm39) H239L probably damaging Het
Chrna7 A G 7: 62,753,538 (GRCm39) M327T probably damaging Het
Cimip2b T C 4: 43,427,574 (GRCm39) H250R possibly damaging Het
Clock T C 5: 76,383,657 (GRCm39) M499V probably benign Het
Clspn A G 4: 126,475,253 (GRCm39) E1002G probably benign Het
Clta C T 4: 44,012,819 (GRCm39) P10S probably damaging Het
Col5a3 A G 9: 20,685,855 (GRCm39) probably null Het
Coq6 T C 12: 84,408,913 (GRCm39) V30A probably benign Het
Csmd2 G T 4: 127,881,921 (GRCm39) R20L probably benign Het
D430041D05Rik A T 2: 104,038,528 (GRCm39) V1547D probably damaging Het
Dapk1 C T 13: 60,865,861 (GRCm39) P153S probably benign Het
Dock2 T A 11: 34,189,536 (GRCm39) Y1545F probably damaging Het
Dpp6 G T 5: 27,839,546 (GRCm39) G354C probably damaging Het
Dyrk1b T C 7: 27,881,856 (GRCm39) L105P probably damaging Het
Epor A G 9: 21,873,155 (GRCm39) S86P probably benign Het
Gale C A 4: 135,695,148 (GRCm39) S341* probably null Het
Galnt4 T A 10: 98,945,355 (GRCm39) V360E probably damaging Het
Gart A T 16: 91,419,833 (GRCm39) C24* probably null Het
Gcnt2 G T 13: 41,040,966 (GRCm39) V42L probably benign Het
Herc6 A G 6: 57,636,698 (GRCm39) I805V probably benign Het
Ints12 T A 3: 132,804,214 (GRCm39) I67N probably benign Het
Irx1 C A 13: 72,108,232 (GRCm39) R150L probably damaging Het
Kif26b A G 1: 178,358,024 (GRCm39) Y45C unknown Het
Krt35 T C 11: 99,984,834 (GRCm39) T275A probably damaging Het
Laptm5 G T 4: 130,643,316 (GRCm39) probably benign Het
Lin7a T C 10: 107,248,027 (GRCm39) S111P unknown Het
Med27 A G 2: 29,414,470 (GRCm39) D159G probably damaging Het
Msh2 A G 17: 88,016,006 (GRCm39) K546R probably damaging Het
Myo1a A T 10: 127,556,020 (GRCm39) probably null Het
Myo1c T C 11: 75,559,019 (GRCm39) F604L probably damaging Het
Myrip A G 9: 120,293,850 (GRCm39) K782E probably damaging Het
Ndc80 T C 17: 71,828,063 (GRCm39) D88G probably damaging Het
Nrxn2 A G 19: 6,505,282 (GRCm39) D375G probably damaging Het
Or2y10 T C 11: 49,455,545 (GRCm39) S266P probably damaging Het
Or52e7 A G 7: 104,685,280 (GRCm39) I292V probably benign Het
Padi3 T C 4: 140,525,422 (GRCm39) H187R probably damaging Het
Pcdhgb1 A T 18: 37,814,610 (GRCm39) N367I probably damaging Het
Pdrg1 T C 2: 152,854,310 (GRCm39) I77V probably benign Het
Pfas T C 11: 68,881,895 (GRCm39) E930G probably benign Het
Pik3cb C T 9: 98,943,817 (GRCm39) R662Q probably benign Het
Pla2g4e T G 2: 120,016,863 (GRCm39) H226P possibly damaging Het
Plxnd1 A T 6: 115,971,237 (GRCm39) V177E probably damaging Het
Prmt7 A G 8: 106,976,961 (GRCm39) S558G possibly damaging Het
Pspc1 A C 14: 57,015,246 (GRCm39) probably null Het
Rilp T C 11: 75,403,586 (GRCm39) S343P probably benign Het
Ror1 A G 4: 100,265,107 (GRCm39) M194V probably damaging Het
Rsu1 T C 2: 13,174,815 (GRCm39) Y225C probably damaging Het
Rundc1 A G 11: 101,324,752 (GRCm39) N486S probably damaging Het
Slc5a11 A G 7: 122,857,601 (GRCm39) E230G probably benign Het
Spint1 T C 2: 119,076,941 (GRCm39) S342P probably damaging Het
Stard3nl A G 13: 19,551,923 (GRCm39) S214P probably damaging Het
Tcp10a A C 17: 7,604,323 (GRCm39) T271P probably damaging Het
Tie1 A G 4: 118,329,831 (GRCm39) Y1091H probably benign Het
Tlr12 T C 4: 128,511,125 (GRCm39) Y375C probably benign Het
Tmem107 T A 11: 68,962,274 (GRCm39) M77K probably damaging Het
Tns2 C T 15: 102,017,369 (GRCm39) R281C probably damaging Het
Tns3 T C 11: 8,481,747 (GRCm39) K202E probably damaging Het
Tspoap1 C T 11: 87,670,347 (GRCm39) P1634L probably damaging Het
Ttc7b G A 12: 100,466,376 (GRCm39) R79C probably damaging Het
Ush2a A G 1: 188,643,844 (GRCm39) N4402S probably benign Het
Vmn2r13 A T 5: 109,304,322 (GRCm39) I703N probably damaging Het
Xrcc4 A G 13: 90,210,126 (GRCm39) probably null Het
Zp3 A T 5: 136,013,089 (GRCm39) K168* probably null Het
Other mutations in Sema6d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00155:Sema6d APN 2 124,501,785 (GRCm39) missense possibly damaging 0.91
IGL00508:Sema6d APN 2 124,498,844 (GRCm39) splice site probably benign
IGL00710:Sema6d APN 2 124,504,208 (GRCm39) missense probably benign 0.00
IGL00811:Sema6d APN 2 124,500,389 (GRCm39) missense probably damaging 1.00
IGL01457:Sema6d APN 2 124,495,562 (GRCm39) missense unknown
IGL01524:Sema6d APN 2 124,505,995 (GRCm39) missense possibly damaging 0.86
IGL01598:Sema6d APN 2 124,507,018 (GRCm39) missense probably damaging 1.00
IGL01915:Sema6d APN 2 124,500,491 (GRCm39) splice site probably benign
IGL02365:Sema6d APN 2 124,498,788 (GRCm39) missense probably benign 0.14
IGL02698:Sema6d APN 2 124,495,643 (GRCm39) missense possibly damaging 0.95
IGL02865:Sema6d APN 2 124,505,993 (GRCm39) missense probably damaging 1.00
IGL03018:Sema6d APN 2 124,501,520 (GRCm39) missense possibly damaging 0.95
IGL03333:Sema6d APN 2 124,506,290 (GRCm39) missense possibly damaging 0.83
R0269:Sema6d UTSW 2 124,502,665 (GRCm39) missense possibly damaging 0.63
R0390:Sema6d UTSW 2 124,500,410 (GRCm39) missense probably damaging 1.00
R0541:Sema6d UTSW 2 124,507,197 (GRCm39) missense probably benign 0.25
R0615:Sema6d UTSW 2 124,496,055 (GRCm39) splice site probably benign
R0617:Sema6d UTSW 2 124,502,665 (GRCm39) missense possibly damaging 0.63
R0694:Sema6d UTSW 2 124,505,961 (GRCm39) missense probably damaging 1.00
R0854:Sema6d UTSW 2 124,507,222 (GRCm39) missense probably damaging 0.97
R1630:Sema6d UTSW 2 124,506,265 (GRCm39) missense possibly damaging 0.89
R1682:Sema6d UTSW 2 124,507,069 (GRCm39) missense probably benign 0.21
R1823:Sema6d UTSW 2 124,501,476 (GRCm39) splice site probably null
R1932:Sema6d UTSW 2 124,501,806 (GRCm39) critical splice donor site probably null
R2249:Sema6d UTSW 2 124,501,508 (GRCm39) missense possibly damaging 0.54
R2256:Sema6d UTSW 2 124,506,070 (GRCm39) missense probably damaging 1.00
R2331:Sema6d UTSW 2 124,499,983 (GRCm39) missense probably damaging 1.00
R2910:Sema6d UTSW 2 124,506,957 (GRCm39) missense probably damaging 1.00
R3683:Sema6d UTSW 2 124,496,146 (GRCm39) missense possibly damaging 0.88
R3937:Sema6d UTSW 2 124,498,770 (GRCm39) missense probably benign 0.00
R4135:Sema6d UTSW 2 124,506,040 (GRCm39) missense probably damaging 0.96
R4446:Sema6d UTSW 2 124,505,979 (GRCm39) missense probably damaging 0.98
R4583:Sema6d UTSW 2 124,506,082 (GRCm39) missense probably damaging 1.00
R4822:Sema6d UTSW 2 124,504,214 (GRCm39) missense possibly damaging 0.79
R4884:Sema6d UTSW 2 124,498,738 (GRCm39) splice site probably null
R5288:Sema6d UTSW 2 124,506,166 (GRCm39) missense probably damaging 1.00
R5443:Sema6d UTSW 2 124,498,756 (GRCm39) missense probably damaging 1.00
R5504:Sema6d UTSW 2 124,499,941 (GRCm39) missense probably damaging 1.00
R5534:Sema6d UTSW 2 124,501,735 (GRCm39) missense possibly damaging 0.75
R5615:Sema6d UTSW 2 124,498,821 (GRCm39) missense probably damaging 0.97
R5747:Sema6d UTSW 2 124,506,867 (GRCm39) missense probably damaging 0.99
R5866:Sema6d UTSW 2 124,506,262 (GRCm39) missense probably benign 0.26
R5980:Sema6d UTSW 2 124,506,628 (GRCm39) missense probably damaging 1.00
R6670:Sema6d UTSW 2 124,496,762 (GRCm39) small deletion probably benign
R6803:Sema6d UTSW 2 124,505,970 (GRCm39) missense probably damaging 0.96
R7023:Sema6d UTSW 2 124,506,831 (GRCm39) missense probably damaging 1.00
R7068:Sema6d UTSW 2 124,499,741 (GRCm39) missense probably benign
R7426:Sema6d UTSW 2 124,496,078 (GRCm39) missense probably damaging 1.00
R7556:Sema6d UTSW 2 124,496,109 (GRCm39) missense probably damaging 1.00
R7569:Sema6d UTSW 2 124,499,892 (GRCm39) missense possibly damaging 0.92
R8427:Sema6d UTSW 2 124,507,197 (GRCm39) missense probably benign 0.25
R8690:Sema6d UTSW 2 124,506,937 (GRCm39) missense probably benign 0.07
R8711:Sema6d UTSW 2 124,502,232 (GRCm39) missense possibly damaging 0.54
R8757:Sema6d UTSW 2 124,497,134 (GRCm39) missense probably damaging 1.00
R8759:Sema6d UTSW 2 124,497,134 (GRCm39) missense probably damaging 1.00
R8868:Sema6d UTSW 2 124,496,114 (GRCm39) missense probably damaging 1.00
R9511:Sema6d UTSW 2 124,499,943 (GRCm39) missense probably damaging 1.00
R9586:Sema6d UTSW 2 124,496,096 (GRCm39) missense probably damaging 1.00
R9731:Sema6d UTSW 2 124,506,117 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTTCCTACAAGTGCTATATACAGC -3'
(R):5'- CTGGATGTGACACTGAACGC -3'

Sequencing Primer
(F):5'- CAGCTAATCAATGCTGGCTATTG -3'
(R):5'- CTGGATGTGACACTGAACGCTTTAAC -3'
Posted On 2015-09-25