Incidental Mutation 'R4599:Ints12'
ID 345414
Institutional Source Beutler Lab
Gene Symbol Ints12
Ensembl Gene ENSMUSG00000028016
Gene Name integrator complex subunit 12
Synonyms Phf22, 4930529N21Rik, 1110020M19Rik, A230056J18Rik, 2810027J24Rik
MMRRC Submission 041815-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R4599 (G1)
Quality Score 225
Status Not validated
Chromosome 3
Chromosomal Location 132797616-132816749 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 132804214 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 67 (I67N)
Ref Sequence ENSEMBL: ENSMUSP00000029650 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029650]
AlphaFold Q9D168
PDB Structure Solution structure of PHD domain in protein NP_082203 [SOLUTION NMR]
Predicted Effect probably benign
Transcript: ENSMUST00000029650
AA Change: I67N

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000029650
Gene: ENSMUSG00000028016
AA Change: I67N

DomainStartEndE-ValueType
internal_repeat_1 23 67 4.54e-5 PROSPERO
low complexity region 74 82 N/A INTRINSIC
internal_repeat_1 91 139 4.54e-5 PROSPERO
PHD 160 212 4.63e-9 SMART
low complexity region 219 240 N/A INTRINSIC
low complexity region 269 291 N/A INTRINSIC
low complexity region 337 373 N/A INTRINSIC
low complexity region 381 436 N/A INTRINSIC
low complexity region 451 461 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160036
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160669
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] INTS12 is a subunit of the Integrator complex, which associates with the C-terminal domain of RNA polymerase II large subunit (POLR2A; MIM 180660) and mediates 3-prime end processing of small nuclear RNAs U1 (RNU1; MIM 180680) and U2 (RNU2; MIM 180690) (Baillat et al., 2005 [PubMed 16239144]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 T C 7: 119,854,626 (GRCm39) V930A probably benign Het
Ankrd13b T C 11: 77,362,494 (GRCm39) R677G probably benign Het
Apc T A 18: 34,451,040 (GRCm39) Y2611* probably null Het
Apold1 A G 6: 134,961,032 (GRCm39) Y162C probably damaging Het
Atp6v0a4 T C 6: 38,055,737 (GRCm39) I325V probably benign Het
Cab39 A G 1: 85,776,050 (GRCm39) Y249C probably damaging Het
Cd22 T A 7: 30,575,325 (GRCm39) H239L probably damaging Het
Chrna7 A G 7: 62,753,538 (GRCm39) M327T probably damaging Het
Cimip2b T C 4: 43,427,574 (GRCm39) H250R possibly damaging Het
Clock T C 5: 76,383,657 (GRCm39) M499V probably benign Het
Clspn A G 4: 126,475,253 (GRCm39) E1002G probably benign Het
Clta C T 4: 44,012,819 (GRCm39) P10S probably damaging Het
Col5a3 A G 9: 20,685,855 (GRCm39) probably null Het
Coq6 T C 12: 84,408,913 (GRCm39) V30A probably benign Het
Csmd2 G T 4: 127,881,921 (GRCm39) R20L probably benign Het
D430041D05Rik A T 2: 104,038,528 (GRCm39) V1547D probably damaging Het
Dapk1 C T 13: 60,865,861 (GRCm39) P153S probably benign Het
Dock2 T A 11: 34,189,536 (GRCm39) Y1545F probably damaging Het
Dpp6 G T 5: 27,839,546 (GRCm39) G354C probably damaging Het
Dyrk1b T C 7: 27,881,856 (GRCm39) L105P probably damaging Het
Epor A G 9: 21,873,155 (GRCm39) S86P probably benign Het
Gale C A 4: 135,695,148 (GRCm39) S341* probably null Het
Galnt4 T A 10: 98,945,355 (GRCm39) V360E probably damaging Het
Gart A T 16: 91,419,833 (GRCm39) C24* probably null Het
Gcnt2 G T 13: 41,040,966 (GRCm39) V42L probably benign Het
Herc6 A G 6: 57,636,698 (GRCm39) I805V probably benign Het
Irx1 C A 13: 72,108,232 (GRCm39) R150L probably damaging Het
Kif26b A G 1: 178,358,024 (GRCm39) Y45C unknown Het
Krt35 T C 11: 99,984,834 (GRCm39) T275A probably damaging Het
Laptm5 G T 4: 130,643,316 (GRCm39) probably benign Het
Lin7a T C 10: 107,248,027 (GRCm39) S111P unknown Het
Med27 A G 2: 29,414,470 (GRCm39) D159G probably damaging Het
Msh2 A G 17: 88,016,006 (GRCm39) K546R probably damaging Het
Myo1a A T 10: 127,556,020 (GRCm39) probably null Het
Myo1c T C 11: 75,559,019 (GRCm39) F604L probably damaging Het
Myrip A G 9: 120,293,850 (GRCm39) K782E probably damaging Het
Ndc80 T C 17: 71,828,063 (GRCm39) D88G probably damaging Het
Nrxn2 A G 19: 6,505,282 (GRCm39) D375G probably damaging Het
Or2y10 T C 11: 49,455,545 (GRCm39) S266P probably damaging Het
Or52e7 A G 7: 104,685,280 (GRCm39) I292V probably benign Het
Padi3 T C 4: 140,525,422 (GRCm39) H187R probably damaging Het
Pcdhgb1 A T 18: 37,814,610 (GRCm39) N367I probably damaging Het
Pdrg1 T C 2: 152,854,310 (GRCm39) I77V probably benign Het
Pfas T C 11: 68,881,895 (GRCm39) E930G probably benign Het
Pik3cb C T 9: 98,943,817 (GRCm39) R662Q probably benign Het
Pla2g4e T G 2: 120,016,863 (GRCm39) H226P possibly damaging Het
Plxnd1 A T 6: 115,971,237 (GRCm39) V177E probably damaging Het
Prmt7 A G 8: 106,976,961 (GRCm39) S558G possibly damaging Het
Pspc1 A C 14: 57,015,246 (GRCm39) probably null Het
Rilp T C 11: 75,403,586 (GRCm39) S343P probably benign Het
Ror1 A G 4: 100,265,107 (GRCm39) M194V probably damaging Het
Rsu1 T C 2: 13,174,815 (GRCm39) Y225C probably damaging Het
Rundc1 A G 11: 101,324,752 (GRCm39) N486S probably damaging Het
Sema6d T A 2: 124,496,151 (GRCm39) I65N probably damaging Het
Slc5a11 A G 7: 122,857,601 (GRCm39) E230G probably benign Het
Spint1 T C 2: 119,076,941 (GRCm39) S342P probably damaging Het
Stard3nl A G 13: 19,551,923 (GRCm39) S214P probably damaging Het
Tcp10a A C 17: 7,604,323 (GRCm39) T271P probably damaging Het
Tie1 A G 4: 118,329,831 (GRCm39) Y1091H probably benign Het
Tlr12 T C 4: 128,511,125 (GRCm39) Y375C probably benign Het
Tmem107 T A 11: 68,962,274 (GRCm39) M77K probably damaging Het
Tns2 C T 15: 102,017,369 (GRCm39) R281C probably damaging Het
Tns3 T C 11: 8,481,747 (GRCm39) K202E probably damaging Het
Tspoap1 C T 11: 87,670,347 (GRCm39) P1634L probably damaging Het
Ttc7b G A 12: 100,466,376 (GRCm39) R79C probably damaging Het
Ush2a A G 1: 188,643,844 (GRCm39) N4402S probably benign Het
Vmn2r13 A T 5: 109,304,322 (GRCm39) I703N probably damaging Het
Xrcc4 A G 13: 90,210,126 (GRCm39) probably null Het
Zp3 A T 5: 136,013,089 (GRCm39) K168* probably null Het
Other mutations in Ints12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00585:Ints12 APN 3 132,806,570 (GRCm39) critical splice donor site probably null
R0243:Ints12 UTSW 3 132,814,806 (GRCm39) missense probably benign 0.37
R0847:Ints12 UTSW 3 132,814,603 (GRCm39) missense possibly damaging 0.72
R2118:Ints12 UTSW 3 132,814,921 (GRCm39) missense probably damaging 0.98
R2323:Ints12 UTSW 3 132,815,126 (GRCm39) missense possibly damaging 0.60
R2324:Ints12 UTSW 3 132,815,126 (GRCm39) missense possibly damaging 0.60
R2384:Ints12 UTSW 3 132,814,864 (GRCm39) splice site probably null
R3055:Ints12 UTSW 3 132,815,126 (GRCm39) missense possibly damaging 0.60
R3056:Ints12 UTSW 3 132,815,126 (GRCm39) missense possibly damaging 0.60
R3919:Ints12 UTSW 3 132,806,444 (GRCm39) missense probably benign
R4431:Ints12 UTSW 3 132,808,242 (GRCm39) missense probably damaging 1.00
R4594:Ints12 UTSW 3 132,814,629 (GRCm39) missense probably benign 0.00
R4598:Ints12 UTSW 3 132,804,214 (GRCm39) missense probably benign
R4702:Ints12 UTSW 3 132,802,546 (GRCm39) missense probably damaging 1.00
R5083:Ints12 UTSW 3 132,806,538 (GRCm39) missense possibly damaging 0.54
R5507:Ints12 UTSW 3 132,814,921 (GRCm39) missense probably damaging 1.00
R5894:Ints12 UTSW 3 132,804,319 (GRCm39) missense probably damaging 1.00
R6647:Ints12 UTSW 3 132,802,639 (GRCm39) missense possibly damaging 0.88
R8245:Ints12 UTSW 3 132,814,633 (GRCm39) missense probably benign
R8887:Ints12 UTSW 3 132,815,003 (GRCm39) missense probably damaging 0.99
R9779:Ints12 UTSW 3 132,812,752 (GRCm39) missense probably benign 0.30
Z1176:Ints12 UTSW 3 132,808,225 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGGAGACTGTTTAGGTCATTACTTTC -3'
(R):5'- TGATGTAACTCCGCCCACTG -3'

Sequencing Primer
(F):5'- ACTGTTTAGGTCATTACTTTCTGTGC -3'
(R):5'- TCCGCCCACTGCTACATAAAG -3'
Posted On 2015-09-25