Incidental Mutation 'R4599:Padi3'
ID 345425
Institutional Source Beutler Lab
Gene Symbol Padi3
Ensembl Gene ENSMUSG00000025328
Gene Name peptidyl arginine deiminase, type III
Synonyms Pdi3, Pad3, PAD type III
MMRRC Submission 041815-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4599 (G1)
Quality Score 225
Status Not validated
Chromosome 4
Chromosomal Location 140512680-140537959 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 140525422 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Arginine at position 187 (H187R)
Ref Sequence ENSEMBL: ENSMUSP00000130721 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026377] [ENSMUST00000172098]
AlphaFold Q9Z184
Predicted Effect probably damaging
Transcript: ENSMUST00000026377
AA Change: H197R

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000026377
Gene: ENSMUSG00000025328
AA Change: H197R

DomainStartEndE-ValueType
Pfam:PAD_N 1 113 2.1e-38 PFAM
Pfam:PAD_M 115 273 4.2e-61 PFAM
Pfam:PAD 283 661 2.3e-169 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000172098
AA Change: H187R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000130721
Gene: ENSMUSG00000025328
AA Change: H187R

DomainStartEndE-ValueType
Pfam:PAD_N 14 103 3.9e-29 PFAM
Pfam:PAD_M 105 263 2.9e-69 PFAM
Pfam:PAD 268 654 5.3e-226 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the peptidyl arginine deiminase family of enzymes, which catalyze the post-translational deimination of proteins by converting arginine residues into citrullines in the presence of calcium ions. The family members have distinct substrate specificities and tissue-specific expression patterns. The type III enzyme modulates hair structural proteins, such as filaggrin in the hair follicle and trichohyalin in the inner root sheath, during hair follicle formation. Together with the type I enzyme, this enzyme may also play a role in terminal differentiation of the epidermis. This gene exists in a cluster with four other paralogous genes. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit alterations in coat/ hair and vibrissa morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 T C 7: 119,854,626 (GRCm39) V930A probably benign Het
Ankrd13b T C 11: 77,362,494 (GRCm39) R677G probably benign Het
Apc T A 18: 34,451,040 (GRCm39) Y2611* probably null Het
Apold1 A G 6: 134,961,032 (GRCm39) Y162C probably damaging Het
Atp6v0a4 T C 6: 38,055,737 (GRCm39) I325V probably benign Het
Cab39 A G 1: 85,776,050 (GRCm39) Y249C probably damaging Het
Cd22 T A 7: 30,575,325 (GRCm39) H239L probably damaging Het
Chrna7 A G 7: 62,753,538 (GRCm39) M327T probably damaging Het
Cimip2b T C 4: 43,427,574 (GRCm39) H250R possibly damaging Het
Clock T C 5: 76,383,657 (GRCm39) M499V probably benign Het
Clspn A G 4: 126,475,253 (GRCm39) E1002G probably benign Het
Clta C T 4: 44,012,819 (GRCm39) P10S probably damaging Het
Col5a3 A G 9: 20,685,855 (GRCm39) probably null Het
Coq6 T C 12: 84,408,913 (GRCm39) V30A probably benign Het
Csmd2 G T 4: 127,881,921 (GRCm39) R20L probably benign Het
D430041D05Rik A T 2: 104,038,528 (GRCm39) V1547D probably damaging Het
Dapk1 C T 13: 60,865,861 (GRCm39) P153S probably benign Het
Dock2 T A 11: 34,189,536 (GRCm39) Y1545F probably damaging Het
Dpp6 G T 5: 27,839,546 (GRCm39) G354C probably damaging Het
Dyrk1b T C 7: 27,881,856 (GRCm39) L105P probably damaging Het
Epor A G 9: 21,873,155 (GRCm39) S86P probably benign Het
Gale C A 4: 135,695,148 (GRCm39) S341* probably null Het
Galnt4 T A 10: 98,945,355 (GRCm39) V360E probably damaging Het
Gart A T 16: 91,419,833 (GRCm39) C24* probably null Het
Gcnt2 G T 13: 41,040,966 (GRCm39) V42L probably benign Het
Herc6 A G 6: 57,636,698 (GRCm39) I805V probably benign Het
Ints12 T A 3: 132,804,214 (GRCm39) I67N probably benign Het
Irx1 C A 13: 72,108,232 (GRCm39) R150L probably damaging Het
Kif26b A G 1: 178,358,024 (GRCm39) Y45C unknown Het
Krt35 T C 11: 99,984,834 (GRCm39) T275A probably damaging Het
Laptm5 G T 4: 130,643,316 (GRCm39) probably benign Het
Lin7a T C 10: 107,248,027 (GRCm39) S111P unknown Het
Med27 A G 2: 29,414,470 (GRCm39) D159G probably damaging Het
Msh2 A G 17: 88,016,006 (GRCm39) K546R probably damaging Het
Myo1a A T 10: 127,556,020 (GRCm39) probably null Het
Myo1c T C 11: 75,559,019 (GRCm39) F604L probably damaging Het
Myrip A G 9: 120,293,850 (GRCm39) K782E probably damaging Het
Ndc80 T C 17: 71,828,063 (GRCm39) D88G probably damaging Het
Nrxn2 A G 19: 6,505,282 (GRCm39) D375G probably damaging Het
Or2y10 T C 11: 49,455,545 (GRCm39) S266P probably damaging Het
Or52e7 A G 7: 104,685,280 (GRCm39) I292V probably benign Het
Pcdhgb1 A T 18: 37,814,610 (GRCm39) N367I probably damaging Het
Pdrg1 T C 2: 152,854,310 (GRCm39) I77V probably benign Het
Pfas T C 11: 68,881,895 (GRCm39) E930G probably benign Het
Pik3cb C T 9: 98,943,817 (GRCm39) R662Q probably benign Het
Pla2g4e T G 2: 120,016,863 (GRCm39) H226P possibly damaging Het
Plxnd1 A T 6: 115,971,237 (GRCm39) V177E probably damaging Het
Prmt7 A G 8: 106,976,961 (GRCm39) S558G possibly damaging Het
Pspc1 A C 14: 57,015,246 (GRCm39) probably null Het
Rilp T C 11: 75,403,586 (GRCm39) S343P probably benign Het
Ror1 A G 4: 100,265,107 (GRCm39) M194V probably damaging Het
Rsu1 T C 2: 13,174,815 (GRCm39) Y225C probably damaging Het
Rundc1 A G 11: 101,324,752 (GRCm39) N486S probably damaging Het
Sema6d T A 2: 124,496,151 (GRCm39) I65N probably damaging Het
Slc5a11 A G 7: 122,857,601 (GRCm39) E230G probably benign Het
Spint1 T C 2: 119,076,941 (GRCm39) S342P probably damaging Het
Stard3nl A G 13: 19,551,923 (GRCm39) S214P probably damaging Het
Tcp10a A C 17: 7,604,323 (GRCm39) T271P probably damaging Het
Tie1 A G 4: 118,329,831 (GRCm39) Y1091H probably benign Het
Tlr12 T C 4: 128,511,125 (GRCm39) Y375C probably benign Het
Tmem107 T A 11: 68,962,274 (GRCm39) M77K probably damaging Het
Tns2 C T 15: 102,017,369 (GRCm39) R281C probably damaging Het
Tns3 T C 11: 8,481,747 (GRCm39) K202E probably damaging Het
Tspoap1 C T 11: 87,670,347 (GRCm39) P1634L probably damaging Het
Ttc7b G A 12: 100,466,376 (GRCm39) R79C probably damaging Het
Ush2a A G 1: 188,643,844 (GRCm39) N4402S probably benign Het
Vmn2r13 A T 5: 109,304,322 (GRCm39) I703N probably damaging Het
Xrcc4 A G 13: 90,210,126 (GRCm39) probably null Het
Zp3 A T 5: 136,013,089 (GRCm39) K168* probably null Het
Other mutations in Padi3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00482:Padi3 APN 4 140,530,935 (GRCm39) missense possibly damaging 0.78
IGL00948:Padi3 APN 4 140,516,254 (GRCm39) missense possibly damaging 0.92
IGL00949:Padi3 APN 4 140,516,254 (GRCm39) missense possibly damaging 0.92
IGL01021:Padi3 APN 4 140,523,645 (GRCm39) splice site probably benign
IGL02400:Padi3 APN 4 140,516,179 (GRCm39) missense probably benign 0.00
IGL02449:Padi3 APN 4 140,517,023 (GRCm39) critical splice donor site probably null
IGL02600:Padi3 APN 4 140,525,467 (GRCm39) missense probably benign 0.15
IGL03342:Padi3 APN 4 140,537,909 (GRCm39) nonsense probably null
FR4304:Padi3 UTSW 4 140,520,283 (GRCm39) critical splice donor site probably benign
PIT4544001:Padi3 UTSW 4 140,518,794 (GRCm39) missense probably benign 0.00
R0455:Padi3 UTSW 4 140,523,024 (GRCm39) missense probably damaging 1.00
R0743:Padi3 UTSW 4 140,513,740 (GRCm39) missense probably benign 0.00
R1279:Padi3 UTSW 4 140,530,888 (GRCm39) missense probably benign 0.00
R2081:Padi3 UTSW 4 140,526,290 (GRCm39) missense probably damaging 1.00
R3016:Padi3 UTSW 4 140,513,898 (GRCm39) missense probably damaging 1.00
R3853:Padi3 UTSW 4 140,518,580 (GRCm39) splice site probably benign
R4909:Padi3 UTSW 4 140,522,937 (GRCm39) missense probably damaging 1.00
R5370:Padi3 UTSW 4 140,537,849 (GRCm39) nonsense probably null
R5482:Padi3 UTSW 4 140,523,154 (GRCm39) missense probably damaging 0.99
R6084:Padi3 UTSW 4 140,523,154 (GRCm39) missense probably damaging 1.00
R6151:Padi3 UTSW 4 140,523,705 (GRCm39) missense probably damaging 1.00
R6277:Padi3 UTSW 4 140,518,472 (GRCm39) critical splice donor site probably null
R6343:Padi3 UTSW 4 140,530,819 (GRCm39) missense possibly damaging 0.58
R6749:Padi3 UTSW 4 140,523,164 (GRCm39) missense possibly damaging 0.94
R7096:Padi3 UTSW 4 140,527,435 (GRCm39) missense probably damaging 1.00
R7403:Padi3 UTSW 4 140,527,430 (GRCm39) missense probably benign
R7798:Padi3 UTSW 4 140,513,750 (GRCm39) missense probably benign
R7818:Padi3 UTSW 4 140,525,453 (GRCm39) missense possibly damaging 0.72
R8375:Padi3 UTSW 4 140,525,407 (GRCm39) missense probably damaging 1.00
R8887:Padi3 UTSW 4 140,523,795 (GRCm39) nonsense probably null
R9036:Padi3 UTSW 4 140,523,004 (GRCm39) missense probably benign 0.00
R9339:Padi3 UTSW 4 140,522,928 (GRCm39) missense probably benign 0.11
R9403:Padi3 UTSW 4 140,537,843 (GRCm39) missense probably benign
RF025:Padi3 UTSW 4 140,520,283 (GRCm39) critical splice donor site probably benign
RF032:Padi3 UTSW 4 140,520,283 (GRCm39) critical splice donor site probably benign
RF040:Padi3 UTSW 4 140,520,283 (GRCm39) critical splice donor site probably benign
RF043:Padi3 UTSW 4 140,520,283 (GRCm39) critical splice donor site probably benign
Z1176:Padi3 UTSW 4 140,525,434 (GRCm39) missense not run
Z1176:Padi3 UTSW 4 140,522,982 (GRCm39) missense possibly damaging 0.92
Z1177:Padi3 UTSW 4 140,525,434 (GRCm39) missense not run
Predicted Primers PCR Primer
(F):5'- AAGCCACCCAAGTTCTGTGC -3'
(R):5'- GTATACACGCCCCTCTGTTG -3'

Sequencing Primer
(F):5'- CACGAAGAAACCCTGTCTTTGTGG -3'
(R):5'- CTGTTGTTCGCATCAATGAATTC -3'
Posted On 2015-09-25